Entoloma pleopodium

(Bull.) Noordel. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Entolomataceae/Entoloma

At a glance

Occurrence records1 242

Data sources9

Biological traits0

DNA specimens4

eDNA detections19

Sources9 archives

Databases and archives Entoloma pleopodium's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 242 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS5 compounds

Occurrence & distributionGBIF1 242 records

Environmental DNA3 datasets · 5 countries19 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

De citroengele satijnzwam is een schimmel behorend tot de familie Entolomataceae. Hij leeft saprotroof, in humus van vochtige bossen op voedselrijke grond, in parken en tuinen, vaak onder brandnetels (Urtica) op stikstofrijke plaatsen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition5 compounds

Compounds documented for Entoloma pleopodium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthraquinones and anthrones5

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
Aloe emodin	present	NPASS
Aloe-emodin 8-O-beta-D-glucopyranoside	present	NPASS
Chrysophanein	present	NPASS
Emodin 1-O-beta-D-glucoside	present	NPASS
Physcion	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Entoloma pleopodium has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences4

eDNA detections19

Countries5

The DNA barcodea real sequence read deposited for this species

ITSON970021.1 ↗584 bpNorway · 2014

ACGT

CATTATTGAATAAACTTGGTTGGGTTGTTGCTGGCTCTTCGGAGCATGTGCACGCTCAATCCATTTTTAACCACCTGTGCACCTTTTGTA …

Entoloma pleopodium voucher O-F-248000 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type1 242 records

Wild obs. + sensor970

Museum / vouchered267

Other5

Range

Area of Occupancy AOO3 328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 214≤1 km 118≤10 km 580>10 km 1

913 georeferenced · 57 without coordinates

Open the mapobservation + sensor970

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 28≤1 km 76≤10 km 42>10 km 2

148 georeferenced · 119 without coordinates

Open the institutions mapphysical evidence267

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	24
Copenhagen, DK	20
Zürich, CH	20
WU-MYClocation not on record	19
Göteborg, SE	13
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	12
SLU Artdatabankenlocation not on record	11
BDBClocation not on record	8
LDlocation not on record	8
Kew, GB	7
Görlitz, DE	6
Helsinki, FI	5
Karlsruhe, DE	5
Adam Mickiewicz University in Poznańlocation not on record	5
GJOlocation not on record	4
Philadelphia, US	4
Uppsala, SE	4
University of Oslo, Natural History Museumlocation not on record	3
Tilburg, NL	3
San Sebastián, ES	3
TUR-Alocation not on record	2
TROMlocation not on record	2
Kuopio, FI	2
MeiseBGlocation not on record	2
Santa Cruz, US	2
CJBGlocation not on record	1
Joensuu, FI	1
Turku, FI	1
Salzburg, AT	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Bardejov, SK	1
Staten Island, US	1
HabitatVisionlocation not on record	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
Gijón, ES	1

35 institutions · 204 of 267 vouchered records shown · 63 without an institution code

09Environmental DNA19 detections

Where the DNA of Entoloma pleopodium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys3

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map5 countries0

Indomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 10.8–15.0

Seasonal swing summer↔winter22.1 °C

Max temp (day)18.1 °C 13.9–19.6

Min temp (night)10.9 °C 7.30–11.4

Precipitation87.7 mm/mo 42.5–169

Air humidity62.9 % 59.2–65.9

Moisture balance15.6 mm/mo -31.4–109

Vapour deficit610 Pa 471–695

Wind speed2.50 m/s 2.00–4.00

Cloud cover45.6 % 39.7–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Entoloma pleopodium

At a glance

Sources9 archives

Compound class profile1 class

Documented compounds5 total

At a glance

Record type1 242 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 242 records