Entoloma medianox

C.F.Schwarz · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Entolomataceae/Entoloma

At a glance

Occurrence records859

Data sources7

Biological traits0

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Entoloma medianox's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility859 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF859 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Entoloma medianox is a species of agaric (gilled mushroom) in the family Entolomataceae. It is known from western North America, where it was previously referred to the European species Entoloma bloxamii or E. madidum. Molecular research, based on cladistic analysis of DNA sequences, has, however, shown that Entoloma medianox is distinct.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Entoloma medianox has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP852559.1 ↗434 bpUSA · 2012

ACGT

ATACATACAACCTAACAAAGAATAAATGACCTTTTAAATAAATTAATACAACTTTCAACAATGGATTTCTTGGCTCTTGCATCGATGAAG …

Entoloma medianox voucher UCSC-0338 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type859 records

Wild obs. + sensor849

Museum / vouchered10

Range

Area of Occupancy AOO1 540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 392≤1 km 133≤10 km 99>10 km 61

685 georeferenced · 164 without coordinates

Open the mapobservation + sensor849

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 2≤10 km 6

8 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Cruz, US	8
California State University, East Baylocation not on record	2

2 institutions · 10 of 10 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Entoloma medianox was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 13.0–13.9

Seasonal swing summer↔winter5.30 °C

Max temp (day)17.0 °C

Min temp (night)11.0 °C 10.2–11.8

Precipitation71.8 mm/mo 59.1–84.3

Air humidity66.2 % 66.1–66.3

Vapour deficit522 Pa 504–541

Cloud cover39.9 % 37.2–42.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)