Entoloma luteum

Peck · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Entolomataceae/Entoloma

At a glance

Occurrence records271

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Entoloma luteum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility271 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF271 records

DNA & barcodingNCBIsequences

01Narrative

Entoloma luteum is a mushroom in the family Entolomataceae. It was described in 1902 by mycologist Charles Horton Peck. Found in North America, it fruits singly or in clusters on the ground in mixed forest. Its angular spores are non-amyloid, hyaline (translucent), and measure 9–13 by 8–12 µm. Entoloma murrayi is a lookalike species that has a more orange cap with a pointy umbo.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Entoloma luteum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSJQ281486.1 ↗661 bp

ACGT

TTGATTGAATTGTTGCTGGCTTTCTTTTTAGAAGCATGTGCACATTCAATTCAATTTTCAAACCCCATGTGCACTTGTTGTAGATCTGAA …

Entoloma luteum voucher GDGM27698 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

08Occurrence & distribution

Record type271 records

Wild obs. + sensor240

Museum / vouchered31

Range

Area of Occupancy AOO900 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 108≤1 km 29≤10 km 21>10 km 23

181 georeferenced · 59 without coordinates

Open the mapobservation + sensor240

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 2≤1 km 5≤10 km 3>10 km 3

13 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	10
Ann Arbor, US	7
TENN-Flocation not on record	4
Davis and Elkins Collegelocation not on record	3
Catholic University of Pekinglocation not on record	3
Chicago, US	1
Acadia Universitylocation not on record	1
Denver, US	1
Toronto, CA	1

9 institutions · 31 of 31 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)