Entoloma holoconiotum

(Largent & Thiers) Noordel. & Co-David · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Entolomataceae/Entoloma

At a glance

Occurrence records224

Data sources9

Biological traits0

DNA specimens17

eDNA detections20

Sources9 archives

Databases and archives Entoloma holoconiotum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility224 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF224 records

Environmental DNA2 datasets · 1 countries20 detections

DNA & barcodingBOLD · NCBI17 specimens

01Narrative

Entoloma holoconiotum is a mushroom in the family Entolomataceae. It was originally described as Nolanea holoconiota by David Largent and Harry Thiers in 1972. Machiel Noordeloos and Co-David transferred it to the genus Entoloma in 2009. The species can be found in conifer forests in western North America. The cap is tan or orangish and ranges from 2–6 cm in diameter. The gills are white. The stalks are pale yellow, measuring 3–7 cm tall and 3–4 mm wide. The spores are brownish pink. Similar species include Entoloma cuneatum, E. propinquum, and E. vernum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Entoloma holoconiotum has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes1

GenBank sequences10

eDNA detections20

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ272379.1 ↗299 bpUSA · 1965

ACGT

GAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTTTCTAGCTTTTACGAAGGCTAG …

Entoloma holoconiotum isolate MICH CIB Cooke 34946 voucher MICH:243490 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type224 records

Wild obs. + sensor190

Museum / vouchered34

Range

Area of Occupancy AOO684 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 103≤1 km 20≤10 km 15>10 km 13

151 georeferenced · 39 without coordinates

Open the mapobservation + sensor190

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 34 records without

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
California State University, East Baylocation not on record	16
Denver, US	5
WTUlocation not on record	1
Chicago, US	1

4 institutions · 23 of 34 vouchered records shown · 11 without an institution code

09Environmental DNA20 detections

Where the DNA of Entoloma holoconiotum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 7.60–16.8

Seasonal swing summer↔winter19.8 °C

Max temp (day)18.1 °C 13.9–24.1

Min temp (night)4.30 °C 1.80–10.7

Precipitation35.8 mm/mo 10.7–88.7

Air humidity48.3 % 43.7–53.8

Moisture balance-92.4 mm/mo -156–10.0

Vapour deficit687 Pa 529–1,091

Wind speed2.30 m/s 1.30–4.10

Cloud cover30.7 % 13.2–37.1

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)