Entoloma griseocyaneum

(Fr.) P.Kumm. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Entolomataceae/Entoloma

At a glance

Occurrence records3 467

Data sources9

Biological traits0

DNA specimens25

eDNA detections53

Sources9 archives

Databases and archives Entoloma griseocyaneum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 467 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 467 records

Environmental DNA3 datasets · 6 countries53 detections

DNA & barcodingBOLD · NCBI25 specimens

01Narrative

Entoloma griseocyaneum is a species of agaric (gilled mushroom) in the family Entolomataceae. It has been given the recommended English name of Felted Pinkgill. The species has a European distribution, occurring mainly in agriculturally unimproved grassland. Threats to its habitat have resulted in the Felted Pinkgill being assessed as globally "vulnerable" on the IUCN Red List of Threatened Species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Entoloma griseocyaneum has left across the world's sequence archives.

At a glance

DNA specimens25

Marker genes2

GenBank sequences8

eDNA detections53

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMF977959.1 ↗638 bp

ACGT

CATTATTGAATAAGCTTGGTTTCAGACTGTTGCTGGTTCTGTAGGGCATGTGCACGTCTGTTCCATTTTTATTACCACCTGTGCACTTCG …

Entoloma griseocyaneum voucher K(M):199790 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8★ITS1

fungal barcode

08Occurrence & distribution

Record type3 467 records

Wild obs. + sensor2 746

Museum / vouchered717

Other4

Range

Area of Occupancy AOO6 312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 1 631≤1 km 532≤10 km 425>10 km 7

2 595 georeferenced · 151 without coordinates

Open the mapobservation + sensor2 746

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 433≤1 km 96≤10 km 23>10 km 8

560 georeferenced · 157 without coordinates

Open the institutions mapphysical evidence717

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	388
Copenhagen, DK	54
SLU Artdatabankenlocation not on record	29
TROMlocation not on record	16
University of Oslo, Natural History Museumlocation not on record	15
Göteborg, SE	15
Uppsala, SE	14
nsnflocation not on record	13
WU-MYClocation not on record	11
Kew, GB	10
BDBClocation not on record	9
Trondheim, NO	8
Karlsruhe, DE	6
LDlocation not on record	6
Tromso University Museumlocation not on record	6
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Philadelphia, US	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Universidade de Lisboa, Museu Bocagelocation not on record	3
GJOlocation not on record	3
Oulu, FI	3
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Bronx, US	2
TUR-Alocation not on record	2
Umeå Universitylocation not on record	1
HabitatVisionlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Chicago, US	1
Gijón, ES	1
Turku, FI	1
Helsinki, FI	1

31 institutions · 635 of 717 vouchered records shown · 82 without an institution code

09Environmental DNA53 detections

Where the DNA of Entoloma griseocyaneum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys3

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map6 countries0

Grazed mountain slope (30-130 moh).kalkrik beitemark (grunnlendt, noe sesongfuk…NA T32-C-7 Sterkt kalkrik eng med mindre hev…I gml. slÃ¥tteengSlatteeng, litt kalkrikBeita skjellsandeng

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 7.00–27.2

Seasonal swing summer↔winter20.2 °C

Max temp (day)13.2 °C 8.90–32.2

Min temp (night)7.10 °C 3.80–23.4

Precipitation170 mm/mo 79.7–209

Air humidity63.1 % 60.4–66.2

Moisture balance63.6 mm/mo 3.50–198

Vapour deficit466 Pa 352–1,236

Wind speed2.80 m/s 1.40–5.70

Cloud cover43.5 % 22.8–64.1

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Entoloma griseocyaneum

At a glance

Sources9 archives

At a glance

Record type3 467 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 467 records