Entoloma formosum

(Fr.) Noordel. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Entolomataceae/Entoloma

At a glance

Occurrence records1 957

Data sources8

Biological traits0

DNA specimens32

eDNA detections33

Sources8 archives

Databases and archives Entoloma formosum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 957 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 957 records

Environmental DNA2 datasets · 5 countries33 detections

DNA & barcodingBOLD · NCBI32 specimens

01Narrative

Dzwonkówka żółtawa – gatunek grzybów z rodziny dzwonkówkowatych (Entolomataceae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Entoloma formosum has left across the world's sequence archives.

At a glance

DNA specimens32

Marker genes1

GenBank sequences10

eDNA detections33

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPZ340424.1 ↗696 bpFrance · 2024

ACGT

CGTAGGTGACCTGCGGAGGATCATTATTGAATAAATTTGGTTTAGGCTGTTGCTGGTCCTGTGGGGCATTGTGCACGCCTATTCCTATAT …

Entoloma formosum voucher CORS:FNG/NS/24092604 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type1 957 records

Wild obs. + sensor1 552

Museum / vouchered401

Other4

Origin

Native1

Range

Area of Occupancy AOO5 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 596≤1 km 288≤10 km 433>10 km 48

1 365 georeferenced · 187 without coordinates

Open the mapobservation + sensor1 552

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 198≤1 km 52≤10 km 30>10 km 2

282 georeferenced · 119 without coordinates

Open the institutions mapphysical evidence401

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	163
University of Oslo, Natural History Museumlocation not on record	23
Copenhagen, DK	22
SLU Artdatabankenlocation not on record	19
WU-MYClocation not on record	15
Trondheim, NO	14
Kew, GB	12
Göteborg, SE	11
BDBClocation not on record	9
Uppsala, SE	6
nsnflocation not on record	6
TROMlocation not on record	4
Turku, FI	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	3
Oulu, FI	3
Umeå Universitylocation not on record	3
Universidade de Lisboa, Museu Bocagelocation not on record	2
California State University, East Baylocation not on record	2
St. Paul, US	2
Bronx, US	2
Mlocation not on record	1
CA	1
HabitatVisionlocation not on record	1
Gijón, ES	1
Museo Entomologico de Leonlocation not on record	1
GJOlocation not on record	1
LDlocation not on record	1
San Sebastián, ES	1
Chicago, US	1
Karlsruhe, DE	1
Rene Pomerleau Herbariumlocation not on record	1
Acadia Universitylocation not on record	1
TUR-Alocation not on record	1
JA-CAGPDS-CAMlocation not on record	1

35 institutions · 343 of 401 vouchered records shown · 58 without an institution code

09Environmental DNA33 detections

Where the DNA of Entoloma formosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map5 countries0

PrairieForestCalcareous spruce forestepinette resineuxUgjodslet beitemark/bjorkehageAfrotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.7 °C 9.10–16.2

Seasonal swing summer↔winter17.2 °C

Max temp (day)13.4 °C 10.8–18.4

Min temp (night)9.40 °C 5.80–13.6

Precipitation170 mm/mo 92.4–238

Air humidity63.9 % 61.8–66.3

Moisture balance88.1 mm/mo

Vapour deficit505 Pa 408–620

Wind speed3.80 m/s

Cloud cover50.6 % 44.7–60.3

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Entoloma formosum

At a glance

Sources8 archives

At a glance

Record type1 957 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 957 records