Entoloma cuspidiferum

Noordel. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Entolomataceae/Entoloma

At a glance

Occurrence records244

Data sources8

Biological traits0

DNA specimens13

eDNA detections18

Sources8 archives

Databases and archives Entoloma cuspidiferum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility244 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF244 records

Environmental DNA3 datasets · 4 countries18 detections

DNA & barcodingBOLD · NCBI13 specimens

01Narrative

De knophaarsatijnzwam is een schimmel behorend tot de familie Entolomataceae. Hij leeft saprotroof in veenmosrietland in vochtige duinvallei met kruipwilg.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Entoloma cuspidiferum has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes2

GenBank sequences9

eDNA detections18

Countries5

The DNA barcodea real sequence read deposited for this species

ITSON341026.1 ↗586 bpUSA · 2020

ACGT

CATTATTGAATAAACTTGGTTCGGTTGTTGCTGGCTCTTAGGAGCATGTGCACGCCGACTCCATCTTTAACCACCTGTGCACCTTGTGTA …

Entoloma cuspidiferum voucher iNat56341889 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9★ITS1

fungal barcode

08Occurrence & distribution

Record type244 records

Wild obs. + sensor171

Museum / vouchered73

Range

Area of Occupancy AOO692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 60≤1 km 12≤10 km 61>10 km 2

135 georeferenced · 36 without coordinates

Open the mapobservation + sensor171

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 23≤1 km 9≤10 km 5>10 km 1

38 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	22
University of Oslo, Natural History Museumlocation not on record	9
Copenhagen, DK	7
WU-MYClocation not on record	6
Toronto, CA	3
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Umeå Universitylocation not on record	2
nsnflocation not on record	2
Universidade de Lisboa, Museu Bocagelocation not on record	2
Salzburg, AT	1
Personal Herbarium of Connor Dooleylocation not on record	1
Mlocation not on record	1
Turku, FI	1
Kew, GB	1
San Sebastián, ES	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Vitoria, ES	1

17 institutions · 63 of 73 vouchered records shown · 10 without an institution code

09Environmental DNA18 detections

Where the DNA of Entoloma cuspidiferum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys3

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map4 countries0

Setervoll med naturbeitemark, innafor rute E…SlÃ¥ttemark; pÃ¥ marka

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.70 °C 1.70–15.8

Seasonal swing summer↔winter17.8 °C

Max temp (day)10.5 °C 3.60–17.5

Min temp (night)4.70 °C -0.5–11.0

Precipitation147 mm/mo 90.6–225

Air humidity66.0 % 61.9–67.3

Moisture balance116 mm/mo

Vapour deficit374 Pa 235–691

Wind speed4.70 m/s

Cloud cover51.0 % 45.5–60.5

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)