Entoleuca mammata

(Wahlenb.) J.D.Rogers & Y.M.Ju · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Xylariales/Xylariaceae/Entoleuca

At a glance

Occurrence records571

Data sources11

Biological traits0

DNA specimens5

eDNA detections27

Sources11 archives

Databases and archives Entoleuca mammata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility571 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.03 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS50 compounds

Occurrence & distributionGBIF571 records

Environmental DNA4 datasets · 5 countries27 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceGoaT33 Mbp

01Narrative

Entoleuca mammata is a species of fungus in the genus Entoleuca. It is responsible for the plant disease hypoxylon canker in hardwood trees such as quaking aspen (Populus tremuloides) and other aspens and poplars, Salix myrsinifolia and other willow species, rowan (Sorbus aucuparia), Sitka alder (Alnus viridis), birch (Betula spp.), apple (Malus spp.), oak (Quercus spp.), and hop-hornbeam (Ostrya spp.).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition50 compounds

Compounds documented for Entoleuca mammata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Carbazole alkaloids6

Anthracyclines6

Pimarane and Isopimarane diterpenoids4

Naphthalenones2

Aminosugars1

Documented compounds50 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2R,5S,9R,12S,16R)-2-hydroxy-5-(2-hydroxyethyl)-1,5,12-trimethyl-10-oxatetracyclo[7.6.1.02,7.012,16]hexadec-7-en-11-one	present	LOTUS
(3R,4R)-3,4,5-trihydroxy-3,4-dihydronaphthalen-1(2H)-one	present	LOTUS
(3R,4R)-3,4,8-trihydroxy-3,4-dihydronaphthalen-1(2H)-one	present	LOTUS
(5R)-8,10-dihydroxy-2,5-bis(hydroxymethyl)-5-methylnaphtho[2,3-c]isochromene-7,12-dione	present	NPASS
(7S,9R,10R)-10-[(2S,4S,5S,6S)-4-(dimethylamino)-5-hydroxy-6-methyloxan-2-yl]oxy-9-ethyl-4,6,7,9,11-pentahydroxy-8,10-dihydro-7H-tetracene-5,12-dione	present	NPASS
(7S,9R,10R)-7,10-bis[[(2S,4S,5S,6S)-5-[(2S,4S,5S,6S)-5-[(2S,4S,5S,6S)-4,5-dihydroxy-6-methyloxan-2-yl]oxy-4-hydroxy-6-methyloxan-2-yl]oxy-4-(dimethylamino)-6-methyloxan-2-yl]oxy]-9-ethyl-1,4,6,9,11-pentahydroxy-8,10-dihydro-7H-tetracene-5,12-dione	present	NPASS
(7S,9R,10R)-7,10-Bis[[(2S,4S,5S,6S)-5-[(2S,4S,5S,6S)-5-[(2S,4S,5S,6S)-4,5-dihydroxy-6-methyloxan-2-yl]oxy-4-hydroxy-6-methyloxan-2-yl]oxy-4-(dimethylamino)-6-methyloxan-2-yl]oxy]-9-ethyl-4,6,9,11-tetrahydroxy-8,10-dihydro-7H-tetracene-5,12-dione	present	NPASS
1-(3-indolyl)-2R,3-dihydroxypropan-1-one	present	NPASS
2-[(1R,2S,5R,9S,12R,16S)-2-hydroxy-1,5,12-trimethyl-11-oxo-10-oxatetracyclo[7.6.1.02,7.012,16]hexadec-7-en-5-yl]ethyl hydrogen sulfate	present	LOTUS
2-[(1S,2R,5S,9R,12S,16R)-2-hydroxy-1,5,12-trimethyl-11-oxo-10-oxatetracyclo[7.6.1.02,7.012,16]hexadec-7-en-5-yl]ethyl hydrogen sulfate	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Entoleuca mammata has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences10

eDNA detections27

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMF373477.1 ↗230 bpRomania

ACGT

ATCGCTTGGCTCTGGTTTTATGAAGAACGCAGCGAAATGCTATACTTAGTGTGAATTGCAGAATTCAATGAATCATCCAATCTTTGAACG …

Entoleuca mammata clone cln12 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS2

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Entoleuca mammata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size33 439 999 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Entoleuca mammata0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type571 records

Wild obs. + sensor259

Museum / vouchered310

Other2

Range

Area of Occupancy AOO1 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 93≤1 km 34≤10 km 120

247 georeferenced · 12 without coordinates

Open the mapobservation + sensor259

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 7≤1 km 206≤10 km 19>10 km 11

243 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence310

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TROMlocation not on record	200
Helsinki, FI	29
Copenhagen, DK	14
Zürich, CH	5
WU-MYClocation not on record	4
Olocation not on record	4
Pullman, US	4
DPIlocation not on record	3
SLU Artdatabankenlocation not on record	3
Kuopio, FI	2
Bronx, US	2
St. Paul, US	2
Tartu, EE	1
Gijón, ES	1
Acadia Universitylocation not on record	1
Turku, FI	1
Slovenian Forestry Institutelocation not on record	1
ILLSlocation not on record	1
MeiseBGlocation not on record	1
Ann Arbor, US	1
Göteborg, SE	1
Uppsala, SE	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Karlsruhe, DE	1
San Sebastián, ES	1

25 institutions · 285 of 310 vouchered records shown · 23 without an institution code

09Environmental DNA27 detections

Where the DNA of Entoleuca mammata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys4

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map5 countries0

Birch(Hardwood) dowel buried in soil of a co…Pine(Softwood) dowel buried in soil of a con…Spruce(Softwood) dowel buried in soil of a c…Aspen forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 11.3–14.5

Seasonal swing summer↔winter26.8 °C

Max temp (day)16.0 °C 14.6–17.4

Min temp (night)9.90 °C 8.50–10.8

Precipitation89.4 mm/mo 66.3–102

Air humidity62.1 % 60.9–63.4

Moisture balance8.00 mm/mo 5.30–25.0

Vapour deficit579 Pa 491–647

Wind speed2.40 m/s 2.40–3.70

Cloud cover58.8 % 49.1–58.9

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)