Enteromius manicensis

(Pellegrin, 1919) · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Enteromius

At a glance

Occurrence records50

Data sources7

Biological traits4

DNA specimens13

eDNA detections0

Sources7 archives

Databases and archives Enteromius manicensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility50 records↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF50 records

DNA & barcodingBOLD13 specimens

01Narrative

The Yellow barb ( Enteromius manicensis) is a species of cyprinid fish in the genus Enteromius.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length15 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Enteromius manicensis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P558 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

6Amostly conserved

12Cmostly conserved

18Cmostly conserved

54Gmostly conserved

75Amostly conserved

87Gmostly conserved

111Amostly conserved

123Tmostly conserved

144Cmostly conserved

156Cmostly conserved

159Gmostly conserved

162Cmostly conserved

172Tmostly conserved

174Amostly conserved

180Tmostly conserved

186Cmostly conserved

192Gmostly conserved

195Tmostly conserved

196Tmostly conserved

198Amostly conserved

210Amostly conserved

216Amostly conserved

219Amostly conserved

231Tmostly conserved

243Amostly conserved

246Tmostly conserved

252Tmostly conserved

259Gmostly conserved

261Amostly conserved

264Tmostly conserved

273Cmostly conserved

274Tmostly conserved

279Gmostly conserved

288Amostly conserved

291Cmostly conserved

292Cmostly conserved

294Gmostly conserved

312Cmostly conserved

315Gmostly conserved

345Cmostly conserved

351Cmostly conserved

363Cmostly conserved

372Gmostly conserved

382Gmostly conserved

396Tmostly conserved

406Tmostly conserved

411Cmostly conserved

414Cmostly conserved

423Avariable

438Amostly conserved

444Amostly conserved

450Tmostly conserved

459Amostly conserved

462Amostly conserved

463Tmostly conserved

471Cmostly conserved

483Amostly conserved

487Tmostly conserved

495Cmostly conserved

504Amostly conserved

525Gmostly conserved

543Amostly conserved

546Tmostly conserved

549Tmostly conserved

558Tmostly conserved

TTAGGAGATGACCAAATCTATAATGTTATCGTTACTGCCCACGCCTTCGTAATGATTTTCTTTATAGTAATACCAATCCTTATTGGGGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes4

BINs2

Most divergent pair11.6%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Enteromius argenteussame genus2.2%Enteromius camptacanthussame genus5.6%Enteromius prionacanthussame genus7.2%Enteromius holotaeniasame genus7.9%Enteromius miolepissame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type50 records

Wild obs. + sensor1

Museum / vouchered49

Origin

Native45

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 49 records without

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	45
FishBaselocation not on record	4

2 institutions · 49 of 49 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)