Entada africana

Guill. & Perr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Entada

At a glance

Occurrence records2 313

Data sources10

Biological traits19

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Entada africana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 313 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS · NPASS45 compounds

Occurrence & distributionGBIF2 313 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 28

01Narrative

Entadopsis sudanica là một loài thực vật có hoa trong họ Đậu. Loài này được (Schweinf.) Gilbert & Boutique mô tả khoa học đầu tiên năm 1952.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height6 m

Plant height max6.1 m

Seed mass204 mg

⚠ sources differ — TRY: 204 mg · GIFT: 165 mg

Seed mass max179 mg

Seed mass min151 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition45 compounds

Compounds documented for Entada africana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Oleanane triterpenoids18

Simple coumarins12

Flavones6

Cinnamic acids and derivatives4

Stigmastane steroids2

Documented compounds45 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Syringaresinol	present	NPASS
2-Propenal, 3-(4-hydroxy-3-methoxyphenyl)-	present	NPASS
2-Propenoic acid, 3-(3,4-dihydroxyphenyl)-, ethyl ester	present	NPASS
3-(3,4-Dihydroxyphenyl)Prop-2-Enoic Acid	present	NPASS
3-(3-Hydroxy-4-methoxyphenyl)prop-2-enoic acid	present	NPASS
4-[(3S,3aS,6S,6aS)-6-(4-hydroxy-3,5-dimethoxy-phenyl)-1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan-3-yl]-2,6-dimethoxy-phenol	present	NPASS
4-Hydroxybenzoic acid	present	NPASS
4-Methylbenzaldehyde	present	NPASS
5,8-Dihydroxy-7,4'-dimethoxyflavone	present	NPASS
6,7-dimethoxy-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-2-one	present	NPASS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Entada africana has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKX119334.1 ↗648 bpNigeria

ACGT

GGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGA …

Entada africana ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Entada africana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records16–282n range22median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · Cave1962

CCDB · Cave1962 — Mige 1962

2n 281×CCDB · book-ipcn65

CCDB · book-ipcn65 — Mangenot & M. 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 313 records

Wild obs. + sensor1 882

Museum / vouchered353

Other78

Range

Area of Occupancy AOO5 404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 48≤1 km 4>10 km 8

60 georeferenced · 1 822 without coordinates

Open the mapobservation + sensor1 882

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 7>10 km 1

8 georeferenced · 345 without coordinates

Open the institutions mapphysical evidence353

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
HNBlocation not on record	31
LSF/FSA/UAClocation not on record	27
Saint Louis, US	25
Kew, GB	22
Yaoundé, CM	21
Frankfurt am Main	19
EFGlocation not on record	15
Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record	15
Université du Lomélocation not on record	14
WAGlocation not on record	12
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	8
Adam Mickiewicz University in Poznańlocation not on record	6
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	6
BRLUlocation not on record	5
Xiamen, CN	4
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	3
CNF-UFHBlocation not on record	3
Moscow State Universitylocation not on record	3
Leiden University Medical Centerlocation not on record	3
Plocation not on record	3
University of Oxfordlocation not on record	2
Université National du Béninlocation not on record	2
Elocation not on record	2
Wlocation not on record	2
LSFlocation not on record	2
MeiseBGlocation not on record	1
Mus. Tinro, Vladyvostoklocation not on record	1
IFANlocation not on record	1
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	1
Herbier National du Gabonlocation not on record	1
Montpellier, FR	1
Bronx, US	1
Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record	1
South Kensington, GB	1

34 institutions · 264 of 353 vouchered records shown · 89 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Entada africana

At a glance

Sources10 archives

Size & morphology5

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry2

Other traits1

Compound class profile5 classes

Documented compounds45 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 313 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 34 geolocated

Record type2 313 records