Ensete glaucum

(Roxb.) Cheesman · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Musaceae/Ensete

At a glance

Occurrence records82

Data sources12

Biological traits25

DNA specimens9

eDNA detections8

Sources12 archives

Databases and archives Ensete glaucum's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility82 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF82 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB · GoaT · NCBI≈495 Mbp

01Narrative

Ensete glaucum, the snow banana, has also been classified as Musa nepalensis, Ensete giganteum, or Ensete wilsonii.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology13

Fruit length90 mm

Fruit length max90 mm

Fruit length min90 mm

Fruit width35 mm

Fruit width max35 mm

Fruit width min35 mm

Leaf length1 600 mm

Leaf length max1 800 mm

Leaf length min1 400 mm

Leaf width550 mm

Leaf width max600 mm

Leaf width min500 mm

Plant height5 m

⚠ sources differ — GIFT: 5 m · TRY: 8.5 m

Life cycle & reproduction3

Life formherbaceous tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberself-supporting

Elevation max2 500 m

Elevation mean950 m

Elevation min800 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ensete glaucum has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSLC610749.1 ↗6 816 bp

ACGT

CATGGTTGGCGACGGGCTGTCCGATGGGGTGATCGTGTCGGCATGTGAGTGGTGATGGATTTGTATGCTGTGGTGGGCTCCCTGCTATTG …

Ensete glaucum genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK★rbcL8★ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Ensete glaucum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈494 938 021 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ensete glaucum0.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-indian_vol2 · CCDB · eflora

CCDB · book-indian_vol2 — In Wl 6 : 450

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness93.6% BUSCO

08Occurrence & distribution

Record type82 records

Wild obs. + sensor17

Museum / vouchered42

Cultivated / captive4

Other19

Origin

Native6

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 10≤1 km 2≤10 km 2>10 km 2

16 georeferenced · 1 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence42

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 2 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	16
Taipei, TW	14
Philadelphia, US	2
TAIElocation not on record	2
MSB-3349location not on record	2
Beijing, CN	1
Herbarium of the Department of Botany, University of Tokyolocation not on record	1

7 institutions · 38 of 42 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Ensete glaucum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)