Enkianthus cernuus

(Siebold & Zucc.) Benth. & Hook.fil. ex Makino · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ericaceae/Enkianthus

At a glance

Occurrence records144

Data sources10

Biological traits6

DNA specimens6

eDNA detections16

Sources10 archives

Databases and archives Enkianthus cernuus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility144 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Chemical compositionLOTUS · NPASS37 compounds

Occurrence & distributionGBIF144 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Enkianthus cernuus, the nodding enkianthus, is a species of flowering plant in the family Ericaceae, native to southern Japan. A shrub or small tree that prefers to grow in wet areas, Enkianthus cernuus f. rubens, the drooping red enkianthus, has gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formshrub

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formtree

⚠ sources differ — GIFT: tree · TRY: shrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition37 compounds

Compounds documented for Enkianthus cernuus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Terpenoid alkaloids11

Ursane and Taraxastane triterpenoids6

Polyamines3

Stigmastane steroids3

Lupane triterpenoids2

Documented compounds37 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	LOTUS
(1S,2R,4aS,6aR,6aS,6bR,8R,8aR,10S,12aR,14bS)-10-acetyloxy-8-hydroxy-1,2,6a,6b,9,9,12a-heptamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid	present	LOTUS
(2R)-2-phenyl-9-[(Z)-3-phenylprop-2-enoyl]-1,5,9,14-tetrazabicyclo[12.3.1]octadecan-4-one	present	NPASS
(2R,3S,4R,5R,6R)-2-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S)-2-phenyl-9-[(E)-3-phenylprop-2-enoyl]-1,5,9-triaza-14-azoniabicyclo[12.3.1]octadec-14(18)-en-4-one	present	NPASS
(2S)-2-phenyl-9-[(Z)-3-phenylprop-2-enoyl]-1,5,9-triaza-14-azoniabicyclo[12.3.1]octadec-14(18)-en-4-one	present	NPASS
(3S,4aS,6aR,6aR,6bR,8aR,11R,12S,12aR,14aR,14bS)-4,4,6a,6b,8a,11,12,14b-octamethyl-2,3,4a,5,6,6a,7,8,9,10,11,12,12a,14a-tetradecahydro-1H-picen-3-ol	present	LOTUS
(4aS,6aS,6aS,6bR,8aS,10S,12aR,14bR)-10-hydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(4S,4aR,6R,7R,7aS)-2,4,7-trimethyl-1,3,4,4a,5,6,7,7a-octahydrocyclopenta[c]pyridin-6-ol	present	NPASS
3beta,6beta-Dihydroxy-urs-12-en-28-oic acid	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Enkianthus cernuus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences10

eDNA detections16

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC693823.1 ↗599 bpJapan · 2010

ACGT

AAGTGTTGGATTCAAAGCTGGTGTAAAAGATTATAAATTGACTTATTATACTCCTAACTATGAAACCAAAGATACTGATATCTTGGCAGC …

Enkianthus cernuus f. rubens TF<JPN>:CCB0305 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6★ITS

plant barcodefungal barcode

08Occurrence & distribution

Record type144 records

Wild obs. + sensor2

Museum / vouchered142

Range

Area of Occupancy AOO356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤1 km 3≤10 km 14

17 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence142

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	87
Odawara, JP	18
Kochi, JP	12
Chiba, JP	4
San Jose State University, Museum of Birds and Mammalslocation not on record	4
Nishihara, JP	3
KURAlocation not on record	1
Nishihara, JP	1
Beijing, CN	1
FFPRIlocation not on record	1
Durham, US	1
University of Stellenboschlocation not on record	1
Madison, US	1
Bangkok, TH	1

14 institutions · 136 of 142 vouchered records shown · 1 without an institution code

09Environmental DNA16 detections

Where the DNA of Enkianthus cernuus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–22.5

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C 9.60–25.6

Min temp (night)3.00 °C 3.00–18.2

Precipitation344 mm/mo 249–344

Air humidity64.9 % 64.9–66.8

Moisture balance263 mm/mo 163–263

Vapour deficit428 Pa 428–913

Wind speed2.90 m/s 1.90–2.90

Cloud cover44.6 % 39.3–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)