Engelhardia roxburghiana

Wall. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fagales/Juglandaceae/Engelhardia

At a glance

Occurrence records1 370

Data sources12

Biological traits22

DNA specimens24

eDNA detections15

Sources12 archives

Databases and archives Engelhardia roxburghiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 370 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources22 traits

Chemical compositionLOTUS · NPASS20 compounds

Occurrence & distributionGBIF1 370 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceCCDB · GoaT · NCBI≈885 Mbp

01Narrative

Alfaropsis roxburghiana ist eine ostasiatische Baumart aus der Familie der Walnussgewächse (Juglandaceae). Sie wurde früher meist in die Gattung Engelhardia gestellt. Der Gattungsname Alfaropsis ehrt den costaricanischen Naturforscher Anastasio Alfaro (1865–1951).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height28 m

Life cycle & reproduction5

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Leaf formelliptic

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)14.54 mm²/mg

Other traits5

Leaf marginentire

Leaf spinesno

Leaf thornsno

Sla max14.54 mm²/mg

Sla min14.54 mm²/mg

03Chemical composition20 compounds

Compounds documented for Engelhardia roxburghiana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Dihydroflavonols12

Naphthoquinones2

Diarylether type diarylheptanoids1

Chromones1

Naphthalenones $ Naphthoquinones1

Documented compounds20 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Isosclerone	present	NPASS
(2R,3R)-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyl-tetrahydropyran-2-yl]oxy-chroman-4-one	present	LOTUS
(2R,3R)-3-[(2S,3R,4R,5S,6S)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-2,3-dihydrochromen-4-one	present	LOTUS
(2R,3S)-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2,3-dihydrochromen-4-one	present	LOTUS
(2R,3S)-3-[(2S,3S,4R,5S,6S)-3,5-dihydroxy-6-methyl-4-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-2,3-dihydrochromen-4-one	present	LOTUS
1(2H)-Naphthalenone, 3,4-dihydro-4-hydroxy-, (4S)-	present	NPASS
2-Methoxyjuglone	present	NPASS
4,18-Dihydroxy-2-oxatricyclo[13.3.1.13,7]icosa-1(18),3,5,7(20),15(19),16-hexaen-10-one	present	NPASS
4H-1-Benzopyran-4-one, 3-((6-deoxy-alpha-L-mannopyranosyl)oxy)-5,7-dihydroxy-	present	LOTUS
8-Hydroxy-2-methoxynaphthalene-1,4-dione	present	NPASS

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Engelhardia roxburghiana has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes4

GenBank sequences8

eDNA detections15

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPV833098.1 ↗161 501 bp

ACGT

GTATTTTATGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTAT …

Engelhardia roxburghiana isolate cpHQ3A chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL8★ITS★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Engelhardia roxburghiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈884 777 351 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Engelhardia roxburghiana0.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 162×CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74

CCDB · book-ipcn75-78 — Mehra 1976

CCDB · book-ipcn73-74 — MEHRA, P.N., & A.S. HANS. 1972. Comparison of diploid and natural polyploid hardwoods. J. Indian Bot. soc. 51: 319-325.

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type1 370 records

Wild obs. + sensor1 140

Museum / vouchered228

Other2

Origin

Native17

Range

Area of Occupancy AOO2 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 277≤1 km 67≤10 km 29>10 km 9

382 georeferenced · 758 without coordinates

Open the mapobservation + sensor1 140

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 226 without coordinates

Open the institutions mapphysical evidence228

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	73
Taipei, TW	20
TAIElocation not on record	17
Zhuzhou, CN	17
Xiamen, CN	13
Yangling, CN	12
Siouxland Heritage Museumlocation not on record	10
Zhejiang Museum of Natural Historylocation not on record	10
Beijing, CN	8
Guizhou Forestry Schoollocation not on record	6
Guilin, CN	5
Berlin, DE	5
Herbarium of South China Botanical Gardenlocation not on record	4
Guiyang, CN	4
Vancouver, CA	3
Beijing, CN	3
Yunnan Universitylocation not on record	3
Guiyang, CN	3
Inner Mongolia Universitylocation not on record	3
Jishou Universitylocation not on record	2
Stockholm, SE	2
LDlocation not on record	2
Fort Worth, US	2
Moscow State Universitylocation not on record	1

24 institutions · 228 of 228 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Engelhardia roxburghiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 24.8–28.7

Seasonal swing summer↔winter19.0 °C

Max temp (day)28.5 °C 27.7–31.8

Min temp (night)21.2 °C 20.4–24.5

Precipitation232 mm/mo 152–240

Air humidity64.3 % 64.0–66.8

Moisture balance84.5 mm/mo -15.5–108

Vapour deficit1,153 Pa 1,044–1,414

Wind speed1.70 m/s 1.70–3.30

Cloud cover50.5 % 43.6–51.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Engelhardia roxburghiana

At a glance

Sources12 archives

Size & morphology1

Life cycle & reproduction5

Diet & foraging1

Habitat & environment7

Physiology & chemistry3

Other traits5

Compound class profile5 classes

Documented compounds20 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 370 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 370 records