Engelhardia rigida

Blume · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fagales/Juglandaceae/Engelhardia

At a glance

Occurrence records107

Data sources3

Biological traits13

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Engelhardia rigida's data was compiled from.

GBIFGlobal Biodiversity Information Facility107 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources13 traits

Occurrence & distributionGBIF107 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height40 m

Life cycle & reproduction4

Life formtree

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Engelhardia rigida has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN307516.1 ↗739 bpIndonesia

ACGT

TTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCCCAGCAGAATGACCCGTGA …

Engelhardia rigida voucher EI1516 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type107 records

Wild obs. + sensor1

Museum / vouchered105

Other1

Range

Area of Occupancy AOO292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 105 records without

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	6
University of Stellenboschlocation not on record	5
Saint Louis, US	2
Boise, US	1
Paris, FR	1
Monastir, TN	1
BISHlocation not on record	1

7 institutions · 17 of 105 vouchered records shown · 88 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)