Endospermum myrmecophilum

L.S.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Endospermum

At a glance

Occurrence records270

Data sources7

Biological traits27

DNA specimens7

eDNA detections4

Sources7 archives

Databases and archives Endospermum myrmecophilum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility270 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF270 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Endospermum myrmecophilum là một loài thực vật có hoa trong họ Đại kích. Loài này được L.S.Sm. mô tả khoa học đầu tiên năm 1947.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Fruit length9 mm

Fruit width7 mm

Leaf length132 mm

Leaf width113 mm

Petiole length15 cm

Plant height36 m

Seed length6 mm

Seed width4.5 mm

Life cycle & reproduction6

Flowering timeynnnnnnyyyyy

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacitypartial_resprouting

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapeorbicular ovate peltate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density398 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Endospermum myrmecophilum has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences1

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496564.1 ↗552 bpAustralia · 2013

ACGT

AGTGTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACTAAAGATACTGATATCTTGGCAGCA …

Endospermum myrmecophilum isolate BATT864-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type270 records

Wild obs. + sensor65

Museum / vouchered176

Other29

Origin

Native1

Range

Area of Occupancy AOO560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 15≤10 km 1

16 georeferenced · 49 without coordinates

Open the mapobservation + sensor65

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 7≤1 km 8≤10 km 69>10 km 16

100 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence176

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	70
Brisbane, AU	44
Palmerston, AU	11
Canberra, AU	9
James Cook Townsvillelocation not on record	2
Kew, GB	2
Armidale, AU	2
Kensington, AU	1
Claremont, US	1
BISHlocation not on record	1
Honolulu, US	1
Australian Tropical Herbariumlocation not on record	1
University of Stellenboschlocation not on record	1

13 institutions · 146 of 176 vouchered records shown · 29 without an institution code

09Environmental DNA4 detections

Where the DNA of Endospermum myrmecophilum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 21.9–22.1

Seasonal swing summer↔winter12.9 °C

Max temp (day)27.0 °C 25.8–28.2

Min temp (night)16.8 °C 15.4–18.3

Precipitation160 mm/mo 44.4–275

Air humidity55.9 % 45.9–65.9

Moisture balance9.20 mm/mo -112–131

Vapour deficit1,234 Pa 922–1,546

Wind speed3.60 m/s 3.40–3.90

Cloud cover38.6 % 22.2–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)