Endospermum medullosum

L.S.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Endospermum

At a glance

Occurrence records220

Data sources10

Biological traits21

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Endospermum medullosum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility220 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF220 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Endospermum medullosum, commonly known as the whitewood, is a dioecious plant that grows in the tropical islands. It grows in tropical humid climates. The species is well known for timber.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Fruit length6 mm

Fruit width6 mm

Plant height33 m

Life cycle & reproduction6

Dehiscenceindehiscent

Dispersal typeanimal

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density329 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Endospermum medullosum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJF738624.1 ↗534 bpPapua New Guinea · 2006

ACGT

GTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACTAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAAC …

Endospermum medullosum voucher WP1A0034 ribulose-1,5-bisphophate carboxylase oxygenase (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type220 records

Wild obs. + sensor5

Museum / vouchered169

Other46

Origin

Native3

Range

Area of Occupancy AOO476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 3 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 3≤10 km 18>10 km 3

24 georeferenced · 145 without coordinates

Open the institutions mapphysical evidence169

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	15
Honolulu, US	8
BISHlocation not on record	8
Canberra, AU	4
Mount Annan, AU	3
Kew, GB	2
Museo Entomologico de Leonlocation not on record	2
University of Stellenboschlocation not on record	2
Bronx, US	1
Claremont, US	1
St. Paul, US	1
Smithfield, AU	1

12 institutions · 48 of 169 vouchered records shown · 120 without an institution code

09Environmental DNA1 detections

Where the DNA of Endospermum medullosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.8–22.8

Seasonal swing summer↔winter1.80 °C

Max temp (day)25.4 °C

Min temp (night)20.7 °C

Precipitation341 mm/mo

Air humidity74.2 %

Moisture balance252 mm/mo

Vapour deficit715 Pa

Wind speed2.10 m/s

Cloud cover49.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)