Endocellion glaciale

(Ledeb.) Kuprian. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Endocellion

At a glance

Occurrence records125

Data sources9

Biological traits8

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Endocellion glaciale's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility125 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF125 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 120

01Narrative

Endocellion is a genus of flowering plants in the daisy family Asteraceae.Turczaninow, Nicolai Stepanowitsch ex Herder, Ferdinand Gottfried Theobald Maximilian von. 1865. Bulletin de la Société Imperiale des Naturalistes de Moscou 38(1): 375Tropicos, Endocellion N. Turcz. ex F. von Herder There is only one accepted species, Endocellion glaciale, native to eastern Russia (Krasnoyarsk, Khabarovsk, Magadan).Flann, C (ed) 2009+ Global Compositae Checklist, Endocellion glaciale (Ledeb.) Toman

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology2

Plant height max0.2 m

Plant height min0.1 m

Life cycle & reproduction4

Flowering endAug

Flowering startJul

Life formrhizomatous geophyte

Life spanperennial

Habitat & environment2

Climatesubalpine or subarctic

Habitat GIFTstony places, tundra

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Endocellion glaciale has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKU570801.1 ↗506 bp

ACGT

CAGCCCATTGGGTCCCAAGGATGTTCCATTGGCACAACAACAACCCCCGGCACGGCATGTGCCAAGGAAATTAAACTTAAGAAGGGCCTG …

Endocellion glaciale isolate AST24 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Endocellion glaciale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 120 n = 60

Ploidydiploid inferred

Chromosome records56–1202n range86median120mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 561×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — ZHUKOVA, P.G., & V.V. PETROVSKY. 1971. Chromosome numbers of certain flowering plants of the Wrangel island. (In Russian). Bot. Zurn. 56: 294-305.

2n 601×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — ZHUKOVA, P.G., V.V. PETROVSKY, & T.N. PLIEVA. 1973. The chromosome numbers and taxonomy of some plant species from Siberia and Far East. (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1331-1342.

2n 1121×CCDB · Cave1963

CCDB · Cave1963 — Sokol. & Strel. 1962

2n 1201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type125 records

Wild obs. + sensor76

Museum / vouchered49

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 60≤1 km 8

68 georeferenced · 8 without coordinates

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 3≤10 km 3>10 km 2

10 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Moscow State Universitylocation not on record	43
IWEP FEB RASlocation not on record	3
Institute of the biological problems of the North FEB RASlocation not on record	2
Olocation not on record	1

4 institutions · 49 of 49 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Endocellion glaciale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)