Encheliophis gracilis

(Bleeker, 1856) · species

image placeholder — illustration coming later

Animalia/Chordata/Ophidiiformes/Carapidae/Encheliophis

At a glance

Occurrence records296

Data sources9

Biological traits6

DNA specimens7

eDNA detections7

Sources9 archives

Databases and archives Encheliophis gracilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility135 records↗

OBISOcean Biodiversity Information System161 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS296 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Encheliophis gracilis is een straalvinnige vissensoort uit de familie van parelvissen (Carapidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1856 door Bleeker.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length30 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importanceof no interest

Other traits2

Depth max62 m

Vulnerability26.6

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Encheliophis gracilis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P672 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

ATATCGGCACCCTCTATTTGATCTTCGGTGCCTGGTCCGGCATGATTGGCACGGCCTTGAGCCTCTTAATCCGAGCTGAGCTCGGGCAGC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type296 records

Wild obs. + sensor53

Museum / vouchered243

Origin

Native1

Range

Area of Occupancy AOO428 km²

Depth

0–200 m sunlit35

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 45.5 m · max 180 m · 35 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 12≤1 km 18>10 km 10

40 georeferenced · 13 without coordinates

Open the mapobservation + sensor53

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 15≤1 km 37≤10 km 53>10 km 4

109 georeferenced · 134 without coordinates

Open the institutions mapphysical evidence243

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kagoshima University Museumlocation not on record	21
Australian National Fish Collectionlocation not on record	18
Natick, US	11
CASlocation not on record	9
Sydney, AU	8
Paris, FR	7
Toronto, CA	5
South African Institute for Aquatic Biodiversitylocation not on record	5
Cambridge, US	4
University of California San Diegolocation not on record	4
	4
Museum and Art Gallery of the Northern Territorylocation not on record	3
Frankfurt am Main	3
Copenhagen, DK	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Washington, US	2
DEWlocation not on record	2
Los Angeles, US	1
Ann Arbor, US	1

19 institutions · 113 of 243 vouchered records shown · 2 without an institution code

09Environmental DNA7 detections

Where the DNA of Encheliophis gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 24.1–25.1

Seasonal swing summer↔winter6.30 °C

Max temp (day)25.5 °C 24.9–25.9

Min temp (night)24.0 °C 23.2–24.2

Precipitation0.3 mm/mo 0.2–46.1

Air humidity60.5 % 60.0–62.1

Vapour deficit1,214 Pa 1,177–1,221

Cloud cover19.0 % 13.5–23.0

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)