Emerita analoga

(Stimpson, 1857) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Hippidae/Emerita

At a glance

Occurrence records7 450

Data sources10

Biological traits2

DNA specimens1 746

eDNA detections1 747

Sources10 archives

Databases and archives Emerita analoga's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 382 records↗

OBISOcean Biodiversity Information System68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 747 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 746 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~2.94 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionNPASS51 compounds

Occurrence & distributionGBIF · OBIS7 450 records

Environmental DNA1 datasets · 2 countries1 747 detections

DNA & barcodingBOLD1 746 specimens

Genome at a glanceGoaT2.9 Gbp

01Narrative

Emerita analoga, the Pacific sand crab or Pacific mole crab, is a species of small, sand-burrowing decapod crustacean found living in the sand along the temperate western coasts of North and South America. It is found on exposed sandy beaches in the swash region of the intertidal zone.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

03Chemical composition51 compounds

Compounds documented for Emerita analoga across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Illudalane sesquiterpenoids11

Kaurane and Phyllocladane diterpenoids4

Kaurane and Phyllocladane diterpenoids $ Norkaurane diterpenoids2

Eudesmane sesquiterpenoids1

Cinnamic acids and derivatives1

Documented compounds51 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,13R)-7,7-Dimethyl-8,12,20-trioxapentacyclo[11.8.0.02,11.04,9.014,19]henicosa-2(11),3,5,9,14(19),15,17-heptaen-17-ol	present	NPASS
(1R,3R,4R,7R,9S,10R,13R,14R)-14-(hydroxymethyl)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecane-3,7,14-triol	present	NPASS
(1R,3R,4R,7R,9S,10R,13R,14S)-5,5,9,14-tetramethyltetracyclo[11.2.1.01,10.04,9]hexadecane-3,7-diol	present	NPASS
(1R,4R,7R,9R,10S,13R,15S)-5,5,9,14,14-pentamethyltetracyclo[11.2.1.01,10.04,9]hexadecane-7,15-diol	present	NPASS
(1R,4S,5S,7S,9R,10S,13R,15S)-5-(hydroxymethyl)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-7,15-diol	present	NPASS
(1S,2R,10S,11R)-6,15-bis[(1R)-1,2-dihydroxyethyl]-5,7,10,11,14,16-hexamethylpentacyclo[9.7.0.02,10.03,8.013,18]octadeca-3(8),4,6,13(18),14,16-hexaene-9,12-dione	present	NPASS
(1S,2S,10R,11R)-6,15-bis[(1R)-1,2-dihydroxyethyl]-5,7,10,11,14,16-hexamethylpentacyclo[9.7.0.02,10.03,8.013,18]octadeca-3(8),4,6,13(18),14,16-hexaene-9,12-dione	present	NPASS
(1S,4S,5S,7S,9R,10S,13S,15S,16R)-5-(hydroxymethyl)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-7,15,16-triol	present	NPASS
(2R)-Pteroside B	present	NPASS
(2R,3R)-6-(2-hydroxyethyl)-2-(hydroxymethyl)-2,5,7-trimethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3H-inden-1-one	present	NPASS

05DNA & barcoding1 746 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Emerita analoga has left across the world's sequence archives.

At a glance

DNA specimens1 746

BINs2

Marker genes3

eDNA detections1 747

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P539 bp consensus1 743 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

45Tvariable

69Tvariable

81Gvariable

154Cvariable

156Gvariable

171Gvariable

183Avariable

210Avariable

216Cvariable

222Gvariable

249Avariable

291Gvariable

294Gvariable

354Cmostly conserved

411Cvariable

420Gvariable

426Amostly conserved

429Gmostly conserved

438Amostly conserved

441Cvariable

471Gvariable

489Avariable

ATTATTCGAGCAGAGTTAGGCCAACCAGGAAGACTAATTGGGGATGACCAGATTTATAATGTCATTGTTACTGCCCACGCGTTTGTTATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 40 commonest of 72 variants.

Diversity (π)2.1%

Haplotypes72

BINs2

Most divergent pair4.6%

OtherN.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Emerita analoga carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 943 780 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Emerita analoga2.94 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type7 450 records

Wild obs. + sensor6 982

Museum / vouchered468

Range

Area of Occupancy AOO5 184 km²

Depth

0–200 m sunlit10

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 12 m · max 877.8 m · 12 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 4 216≤1 km 884≤10 km 408>10 km 165

5 673 georeferenced · 1 309 without coordinates

Open the mapobservation + sensor6 982

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 16≤1 km 21≤10 km 40>10 km 8

85 georeferenced · 383 without coordinates

Open the institutions mapphysical evidence468

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	281
CASlocation not on record	27
Washington, US	22
Universidad Católica del Nortelocation not on record	13
Victoria, CA	10
Cambridge, US	9
Los Angeles, US	7
	7
Frankfurt am Main	6
Museum für Naturkunde Berlin (Zoological Collections)location not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Mexico City, MX	3
New Haven, US	2
Helsinki, FI	2
SNSDlocation not on record	2
Universidad del Valle (UniValle)location not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Universidad Austral de Chilelocation not on record	1
University of Oslo (UiO)location not on record	1

19 institutions · 403 of 468 vouchered records shown · 10 without an institution code

09Environmental DNA1 747 detections

Where the DNA of Emerita analoga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 747

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 747 detections have coordinates

Open the map2 countries0

In sand on the shoresand swash zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 14.9–25.7

Seasonal swing summer↔winter27.0 °C

Max temp (day)31.2 °C 20.0–31.2

Min temp (night)21.2 °C 10.7–21.2

Precipitation117 mm/mo 28.9–117

Air humidity56.9 % 56.9–60.3

Moisture balance-100 mm/mo -103–39.0

Vapour deficit1,423 Pa 702–1,423

Wind speed5.10 m/s 3.00–5.10

Cloud cover24.9 % 22.3–30.8

CHELSA 1981–2010, ~9 km grid, at location & month of 53 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Emerita analoga

At a glance

Sources10 archives

Habitat & environment2

Compound class profile5 classes

Documented compounds51 total

At a glance

Genome sizehow big the whole instruction manual is

Record type7 450 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 450 records