Elymus violaceus
(Hornem.) J.Feilberg · speciesAt a glance
Occurrence records885
Data sources12
Biological traits31
DNA specimens94
eDNA detections34
Sources12 archives
Databases and archives Elymus violaceus's data was compiled from.
WikipediaWikimedia Foundation5 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility885 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics94 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources31 traits
Occurrence & distributionGBIF885 records
Environmental DNA1 datasets · 4 countries34 detections
DNA & barcodingBOLD · NCBI94 specimens
Genome at a glanceCCDB2n = 28
01Narrative
Elymus sierrae ( Elymus sierrus) is a species of wild rye known by the common name Sierra wild rye. It is endemic to the High Sierra Nevada in California and far western Nevada, where it grows in coniferous forest and other mountain habitat generally above 2200 m in elevation. It is a perennial grass with stems growing 30 to 50 centimeters long and decumbent along the ground at maturity. The inflorescence is a series of single-spikelet nodes a few centimeters long, each spikelet with an outward-curved awn up to 2.5 centimeters long.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology8
Leaf size190 mm²
Plant height0.91 m
⚠ sources differ — GIFT: 0.91 m · TRY: 0.49 m
Plant height generative0.695 m
Plant height max0.9 m
Plant height min0.75 m
Seed mass2.66 mg
⚠ sources differ — TRY: 2.66 mg · GIFT: 101 mg
Seed mass max4.6 mg
Seed mass min2.67 mg
Life cycle & reproduction6
Deciduousnessdeciduous
Flowering endJul
Flowering startJul
Life formperennial
Life spanperennial
Raunkiær life formhemicryptophyte
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Graminoid
Habitat GIFTmeadows
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio32.03 g/g
Leaf c417 mg/g
Leaf dry-matter content (LDMC)334 mg/g
Leaf n11.51 mg/g
Leaf p1.83 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)11.18 mm²/mg
Other traits1
Shoot orientationerect
05DNA & barcoding94 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elymus violaceus has left across the world's sequence archives.
At a glance
DNA specimens94
Marker genes12
GenBank sequences6
eDNA detections34
Countries4
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCAA …
Elymus violaceus voucher 09PROBE-05653 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL3★rbcLa★trnL-F★ITS2★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Elymus violaceus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidydiploid inferred
Chromosome records28–562n range28median28mode54records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2853×CCDB · iapt · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +9
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · book-ipcn65 — Bowden 1965a
CCDB · ipcn-api-dl — Dewey, D. R. 1976. Cytogenetics of Agropyron pringlei and its hybrids with A. spicatum, A. scriboeri, A. violaccum and A. dasystachyum. Bot. Gaz. 137: 179–185.
CCDB · ipcn-api-dl — Sadasivaiah, R. S. & J. Weijer. 1981a. Cytogenetics of some natural intergeneric hybrids between Elymus and Agropyron species. Canad. J. Genet. Cytol. 23: 131–140.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. Siplivinsky. 1981. In Chromosome number reports LXXIII. Taxon 30: 857–860.
CCDB · ipcn-api-dl — Napier, K. V. & P. D. Walton. 1981. New interspecific hybrids in the genus Agropyron. Euphytica 30: 459–466.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1982. Synopsis of chromosome numbers in Poaceae from the Soviet Far East. I. The tribes Oryzeae, Brachypodieae, Triticeae. Bot. Zhurn. SSSR 67 (1): 62–70.
CCDB · ipcn-api-dl — Love, A. 1980. In IOPB chromosome number reports LXVI. Taxon 29: 166–169.
CCDB · ipcn-api-dl — AUNG, T. & P. D. Walton. 1987. Cytology of triploid and pentaploid hybrids of Elymus trachycaulus x Pseudoroegneria spicata and P. spicata ssp. inermis. Genome 29: 470–480.
CCDB · ipcn-api-dl — Morris, K. L. D. & B. S. Gill. 1987. Genomic affinities of individual chromosomes based on C- and N-banding analyses of tetraploid Elymus species and their diploid progenitor species. Genome 29: 247–252.
CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II. Bot. Žhurn. (Moscow & Leningrad) 75: 118–120.
CCDB · ipcn-api-dl — AUNG, T. & P. D. Walton. 1990. Morphology and cytology of the reciprocal hybrids between Elymus trachycaulus and Elymus canadensis. Genome 33: 123–130.
CCDB · ipcn-api-dl — Jensen, K. B., C. Hsiao & K. H. Asay. 1989. Genomic and taxonomic relationships of Agropyron vaillantianum and E. arizonicus (Poaceae: Triticeae). Genome 32: 640–645.
CCDB · ipcn-api-dl — Balyan, H. S. & G. Fedak. 1991. A study on genome relationships in Hordeum parodii, Hordeum jubatum, Elymus trachycaulus and Elymus canadensis. Cytologia 56: 431–436.
CCDB · ipcn-api-dl — Dubcovsky, J., S. M. Lewis & E. H. Hopp. 1992. Variation in the restriction fragments of 18S--26S rRNA loci in South American Elymus (Triticeae). Genome 35: 881–885.
CCDB · ipcn-api-dl — Jensen, K. B. 1993. Cytogenetics of Elymus magellanicus and its intra- and inter-generic hybrids with Pseudoroegneria spicata, Hordeum violaceum, E. trachycaulus, E. lanceolatus, and E. glaucus (Poaceae: Triticeae). Genome 36: 72–76.
CCDB · ipcn-api-dl — Seberg, O. & I. Linde-Laursen. 1996. Eremium, a new genus of the Triticeae (Poaceae) from Argentina. Syst. Bot. 21(2): 3–15.
CCDB · ipcn-api-dl — Salomon, B. & B. r. Lu. 1994. Genomic relationships between species of the Elymus semicostatus group and Elymus sensu lato (Poaceae). Pl. Syst. Evol. 191: 199–201.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1980b. In Chromosome number reports LXIX. Taxon 29: 707–709.
CCDB · ipcn-api-dl — GERVAIS, C., R. Trahan & J. Gagnon. 1999. IOPB chromosome data 14. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 30: 10–15.
CCDB · ipcn-api-dl — Probatova, N. S., A. P. Sokolovskaja & E. G. Rudyka. 1991. Chromosome numbers in some species of vascular plants from the Soviet Far East and other regions of the USSR. Bot. Žhurn. (Moscow & Leningrad) 76: 1174–1178.
CCDB · book-ipcn66 — Collins 1966
CCDB · book-ipcn66 — Love & Love 1966b
CCDB · book-ipcn72 — ENGELSKJOEN, T., & G. KNABEN. 1971. Chromosome numbers of Scandinavian arctic-alpine plant species. III. Acta Boreal., A, Scientia No. 28: 1-30.
CCDB · book-ipcn67-71 — SCHULZ-SCHAEFFER, J., & P. JURA. 1967. Biosystema tic investigations in the genus Agropyron, IV. Species karyotype analysis, phytogeographic and other biosystematic studies. Zeits. Pflanzenzucht. 57: 146-166.
CCDB · book-ipcn67-71 — ZHUKOVA, P.G . & A.D. TIKHONOVA. 1971. Chromosome numbers of certain plant species indigenous to the Chukotsky province. (In Russian). Bot. Zurn. 56: 868-875.
CCDB · book-ipcn75-78 — Johnson & Jalal 1977
CCDB · book-indian_vol2 — Dewey, D.R. 1974a
CCDB · book-atlas-flowering-plants — Senn et al. 1949
CCDB · book-atlas-flowering-plants — B0cher & L. 1950
CCDB · kew — Vogel KP, Arumuganathan K, Jensen KB. 1999. Nuclear DNA content of perennial grasses of the Triticeae. Crop Science 39: 661-667.
CCDB · Cave1956 — Tateoka b
CCDB · Cave1962 — Schulz-Sch. et al. 1962
CCDB · iapt — IAPT/IOPB Chromosome Data 26
CCDB · iapt — IAPT/IOPB Chromosome Data 29
2n 561×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Napier, K. V. & P. D. Walton. 1981. New interspecific hybrids in the genus Agropyron. Euphytica 30: 459–466.
n 141×CCDB · Cave1956supp
CCDB · Cave1956supp — Boyle & Holmg. 1955
n 281×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — BOYLE, W.S., & A.H. HOLMGREN. 1968. A cytotaxonomic study of a natural hybrid between Agropyron cristatum and ~ subsecundum. Madrono 19: 277-281.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type885 records
Wild obs. + sensor42
Museum / vouchered615
Other228
Origin
Introduced8
Range
Area of Occupancy AOO2 544 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy85% within 1 km
≤100 m 21≤1 km 8≤10 km 3>10 km 2
34 georeferenced · 8 without coordinates
Open the mapobservation + sensor42
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy54% within 1 km
≤100 m 32≤1 km 71≤10 km 80>10 km 7
190 georeferenced · 425 without coordinates
Open the institutions mapphysical evidence615
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions33 of 60 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 99 |
| Victoria, CA | 78 |
| Moscow State Universitylocation not on record | 47 |
| University of Alberta Museumslocation not on record | 45 |
| Bronx, US | 42 |
| Logan, US | 26 |
| Anchorage, US | 25 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 25 |
| Irkutsk State Universitylocation not on record | 16 |
| Québec, CA | 14 |
| WTUlocation not on record | 13 |
| Corvallis, US | 13 |
| Vancouver, CA | 10 |
| Saint Louis, US | 10 |
| Dekalb, US | 10 |
| Whitehorse, CA | 9 |
| University of Stellenboschlocation not on record | 9 |
| St. Paul, US | 8 |
| Denver, US | 8 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 7 |
| Chongqing Museumlocation not on record | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| Olocation not on record | 6 |
| Yellowstone National Park Herbariumlocation not on record | 5 |
| Kew, GB | 5 |
| Rocky Mountain Biological Laboratorylocation not on record | 5 |
| University of Manitoba Herbariumlocation not on record | 4 |
| Toronto, CA | 4 |
| Bloomington, US | 3 |
| Tromso University Museumlocation not on record | 3 |
| Canadian Museum of Naturelocation not on record | 3 |
| Auckland, NZ | 3 |
| Pullman, US | 3 |
| Churchill Northern Studies Centrelocation not on record | 2 |
| Albuquerque, US | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| San Angelo, US | 2 |
| Boise, US | 2 |
| Dresden, DE | 2 |
| Caldwell, US | 2 |
| Montréal, CA | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Pittsburg, US | 2 |
| Tempe, US | 2 |
| Bergen, NO | 1 |
| Paris, FR | 1 |
| Berlin, DE | 1 |
| Ann Arbor, US | 1 |
| Université Lavallocation not on record | 1 |
| Moscow, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| University of British Columbialocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Ashland, US | 1 |
| Philadelphia, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| WINlocation not on record | 1 |
| Millersville, US | 1 |
60 institutions · 610 of 615 vouchered records shown · 4 without an institution code
09Environmental DNA34 detections
Where the DNA of Elymus violaceus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found34
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 34 detections have coordinates
Open the map4 countries0
Idaho-Fescue/Bearded Wheatgrass-Sticky Geran…Alpine tundraMontane meadow; E. longifolius, Juncus mexic…Upland edgeManaged boreal mixedwood standWet forest, subalpine fir/Globe huckleberry-…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.3 °C 6.00–18.5
Seasonal swing summer↔winter27.6 °C
Max temp (day)18.3 °C 10.2–23.5
Min temp (night)7.00 °C 2.40–13.2
Precipitation63.5 mm/mo 52.1–106
Air humidity58.9 % 46.9–64.3
Moisture balance-38.4 mm/mo -79.5–14.9
Vapour deficit696 Pa 347–885
Wind speed2.80 m/s 2.20–3.70
Cloud cover42.4 % 24.9–51.9
CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.