Elymus scribneri

(Vasey) M.E.Jones · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Elymus

At a glance

Occurrence records662

Data sources11

Biological traits16

DNA specimens9

eDNA detections5

Sources11 archives

Databases and archives Elymus scribneri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility662 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF662 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Elymus scribneri is a species of wild rye known by the common names spreading wheatgrass and Scribner's wheatgrass. It is native to much of the western United States and parts of central Canada where it grows in several types of habitat including alpine mountain peaks.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology5

Leaf size413 mm²

Plant height0.167 m

Seed mass0.156 mg

Seed mass max0.156 mg

Seed mass min0.156 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

Physiology & chemistry1

Specific leaf area (SLA)4.4 mm²/mg

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elymus scribneri has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences7

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK802405.1 ↗595 bpUSA · 2013

ACGT

TTTCTGTAGGTGAACCTACGGAAGGATCATTGTCGTGACCCTTAAACAAAATAGACCGTGAACATGTCATCCATGTTGTCGGGCTACGGT …

Elymus scribneri voucher ID:174221 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL6★rbcLa★trnL-F★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Elymus scribneri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 284×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +1

CCDB · ipcn-api-dl — Love, A. 1980. In IOPB chromosome number reports LXVI. Taxon 29: 166–169.

CCDB · book-ipcn66 — Collins 1966

CCDB · book-ipcn67-71 — DEWEY, D.R. 1971. Genome relations among Agropyron spicatum, ~- scribneri, Hordeum brachyantherum and~ arizonicum. Bull. Torr. Bot. Club. 98: 200-206.

CCDB · Cave1956 — Tateoka b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type662 records

Wild obs. + sensor42

Museum / vouchered594

Other26

Origin

Native2

Range

Area of Occupancy AOO1 792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 27≤1 km 3>10 km 1

31 georeferenced · 11 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 64≤1 km 137≤10 km 61>10 km 3

265 georeferenced · 329 without coordinates

Open the institutions mapphysical evidence594

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 51 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	79
Provo, US	60
Bronx, US	58
Denver, US	47
Albuquerque, US	41
Musee des Dinosaures d'Esperaza (Aude)location not on record	36
Rocky Mountain Biological Laboratorylocation not on record	31
Missoula, US	31
Moscow, US	25
Logan, US	20
Flagstaff, US	16
Durango, US	14
DOI/NPS, Greenbelt Parklocation not on record	13
San Angelo, US	12
Pullman, US	9
Wuzhou, CN	7
Riverside, US	6
University of Alberta Museumslocation not on record	6
Bloomington, US	5
Orem, US	5
Davis, US	4
Pocatello, US	4
Claremont, US	4
University of Stellenboschlocation not on record	4
Pittsburg, US	4
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
Vancouver, CA	3
ASUlocation not on record	3
CASlocation not on record	3
Yellowstone National Park Herbariumlocation not on record	3
Saint Louis, US	3
WTUlocation not on record	3
USFSlocation not on record	2
Tempe, US	2
Wlocation not on record	2
St. Paul, US	2
Kew, GB	2
MAlocation not on record	2
Berlin, DE	2
BClocation not on record	1
Los Angeles, US	1
Boise, US	1
Chadron, US	1
Dresden, DE	1
LDlocation not on record	1
Fredericton Stock Culture Collectionlocation not on record	1
Phoenix, US	1
EL PASO, US	1
San Diego, US	1
Weber State Universitylocation not on record	1
Chongqing Museumlocation not on record	1

51 institutions · 589 of 594 vouchered records shown · 5 without an institution code

09Environmental DNA5 detections

Where the DNA of Elymus scribneri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

Alpine tundraRocky outcrop. Looks like Absaroka volcanics

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 12.9–13.2

Seasonal swing summer↔winter23.9 °C

Max temp (day)19.6 °C 19.6–20.1

Min temp (night)6.20 °C 6.20–6.60

Precipitation63.0 mm/mo 55.3–63.0

Air humidity48.5 % 48.5–49.1

Moisture balance-82.9 mm/mo -82.9–-77.4

Vapour deficit773 Pa 773–773

Wind speed2.20 m/s 1.60–2.20

Cloud cover23.5 % 23.5–23.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)