Elymus multisetus

(J.G.Sm.) Burtt Davy · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Elymus

At a glance

Occurrence records1 119

Data sources11

Biological traits18

DNA specimens5

eDNA detections3

Sources11 archives

Databases and archives Elymus multisetus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 119 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF1 119 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Elymus multisetus is a species of wild rye known by the common name big squirreltail.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass3.86 mg

⚠ sources differ — TRY: 3.86 mg · GIFT: 4.11 mg

Seed mass max5.86 mg

Seed mass min2.35 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

Physiology & chemistry5

Leaf C:N ratio18.94 g/g

Leaf c384 mg/g

Leaf dry-matter content (LDMC)594 mg/g

Leaf n20.3 mg/g

Specific leaf area (SLA)8.52 mm²/mg

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elymus multisetus has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences2

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFJ040164.1 ↗601 bp

ACGT

TCGTGACCCTGACCAAAACAGACCGCGCACGAGTCATCCAATCCGTCGGCGACGGCACCGTCCGTCGCTCGGCCAATGCCTCGACCACCT …

Elymus multisetus clone wxl5 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Elymus multisetus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–282n range28median28mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 284×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants · CCDB · Cave1963

CCDB · ipcn-api-dl — Salomon, B., R. v. Bothmer & N. Jacobsen. 1991. Intergeneric crosses between Hordeum and North American Elymus (Poaceae, Triticeae). Hereditas (Lund) 114: 35–39.

CCDB · ipcn-api-dl — Love, A. 1980. In IOPB chromosome number reports LXVI. Taxon 29: 166–169.

CCDB · book-atlas-flowering-plants — Fo

CCDB · Cave1963 — Wilson 1963

n 141×CCDB · Cave1963

CCDB · Cave1963 — Wilson 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 119 records

Wild obs. + sensor241

Museum / vouchered536

Other342

Origin

Native11

Range

Area of Occupancy AOO2 628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 154≤1 km 13≤10 km 4>10 km 11

182 georeferenced · 59 without coordinates

Open the mapobservation + sensor241

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 11≤1 km 167≤10 km 160>10 km 10

348 georeferenced · 188 without coordinates

Open the institutions mapphysical evidence536

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	115
Arcata, US	48
Corvallis, US	42
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	38
Riverside, US	26
San Diego, US	25
Claremont, US	16
San Luis Obispo, US	15
US	14
Bronx, US	11
Canadian Department of Agriculturelocation not on record	10
University of Stellenboschlocation not on record	5
Fredericton Stock Culture Collectionlocation not on record	5
Severin-McDaniel Insect Collectionlocation not on record	4
Los Angeles, US	4
Santa Barbara, US	4
Irvine, US	3
San Jose, US	3
Wuzhou, CN	3
Saint Louis, US	3
DOI/NPS, Colonial National Historical Parklocation not on record	2
Santa Cruz, US	2
Catalina Island Conservancylocation not on record	1
Northridge, US	1
Kew, GB	1
Bureau of Land Management, Medford District Officelocation not on record	1
Portland, US	1
STNFlocation not on record	1
Vancouver, CA	1
Museo Achille Folettolocation not on record	1
San Diego Natural History Museumlocation not on record	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Ann Arbor, US	1
Tampa, US	1

34 institutions · 410 of 536 vouchered records shown · 126 without an institution code

09Environmental DNA3 detections

Where the DNA of Elymus multisetus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Elymus multisetus, Trifolium subterranean, C…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 20.1–20.1

Seasonal swing summer↔winter12.6 °C

Max temp (day)26.6 °C

Min temp (night)15.1 °C

Precipitation2.00 mm/mo

Air humidity59.5 %

Moisture balance-158 mm/mo

Vapour deficit958 Pa

Wind speed1.90 m/s

Cloud cover17.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Elymus multisetus

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 119 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 119 records