Elymus magellanicus

(É.Desv.) Á.Löve · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Elymus

At a glance

Occurrence records144

Data sources11

Biological traits13

DNA specimens2

eDNA detections1

Sources11 archives

Databases and archives Elymus magellanicus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility144 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF144 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Elymus magellanicus, the Magellan wheatgrass, is a clump-forming grass native to South America. It grows 1½-ft high and wide and has metallic blue leaves. Nearly evergreen in mild climates, it is a good container plant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass7.19 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elymus magellanicus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLZ49837.1 ↗1 431 bp

ACGT

ATGTCACCACAAACAGAAACTAAAGCAGGTGTTGGATTTCAAGCTGGTGTTAAAGATTATAAATTGACTTACTACACCCCAGAGTATGAA …

E.glaucescens chloroplast rbcL gene for ribulosebiphosphate carboxylase

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL2

animal barcodeplant barcode

06Genome at a glanceCCDB

The complete instruction manual Elymus magellanicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records14–282n range28median28mode16records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2815×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · Cave1956supp

CCDB · ipcn-api-dl — Moore, D. M. 1981. Cromosome numbers of Fuegian angiosperms. Bol. Soc. Brot. 53: 995–1012.

CCDB · ipcn-api-dl — Dubcovsky, J., M. A. Soria & A. Martínez. 1989. Karyotype analysis of the Patagonian Elymus. Bot. Gaz. 150: 462–468.

CCDB · ipcn-api-dl — Jensen, K. B. 1993. Cytogenetics of Elymus magellanicus and its intra- and inter-generic hybrids with Pseudoroegneria spicata, Hordeum violaceum, E. trachycaulus, E. lanceolatus, and E. glaucus (Poaceae: Triticeae). Genome 36: 72–76.

CCDB · ipcn-api-dl — Dubcovsky, J., S. M. Lewis & E. H. Hopp. 1992. Variation in the restriction fragments of 18S--26S rRNA loci in South American Elymus (Triticeae). Genome 35: 881–885.

CCDB · ipcn-api-dl — Frederiksen, S. 1993. Taxonomic studies in some annual genera of the Triticeae (Poaceae). Nordic J. Bot. 13: 481–493.

CCDB · ipcn-api-dl — Seberg, O. & I. Linde-Laursen. 1996. Eremium, a new genus of the Triticeae (Poaceae) from Argentina. Syst. Bot. 21(2): 3–15.

CCDB · ipcn-api-dl — Linde-Laursen, I., O. Seberg & B. Salomon. 1994. Comparison of the Giemsa C-banded and N-banded karyotypes of two Elymus species, E. dentatus and E. glaucescens (Poaceae: Triticeae). Pl. Syst. Evol. 192: 165–176.

CCDB · book-ipcn66 — Hunziker 1966b

CCDB · Cave1956supp — Hunziker 1954

2n 141×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Dewey, D. R. 1982. Cytogenetics of Agropyron ferganense and its hybrids with six species of Agropyron, Elymus and Sitanion. Amer. J. Bot. 68: 216–225.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type144 records

Wild obs. + sensor19

Museum / vouchered93

Cultivated / captive5

Other27

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 9≤1 km 2≤10 km 2>10 km 2

15 georeferenced · 4 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 1

3 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence93

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 4 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	24
San Isidro, AR	22
Ciudad Autónoma de Buenos Aires, AR	14
University of Stellenboschlocation not on record	7
Castelar, AR	7
Wlocation not on record	4
LDlocation not on record	3
Columbia, US	2
Saint Louis, US	2
Logan, US	1
Paris, FR	1
NAlocation not on record	1
Berlin, DE	1
Philadelphia, US	1
BClocation not on record	1
Auckland, NZ	1
South Kensington, GB	1

17 institutions · 93 of 93 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Elymus magellanicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)