Elymus elymoides
(Raf.) Swezey · speciesAt a glance
Occurrence records7 394
Data sources10
Biological traits103
DNA specimens33
eDNA detections16
Sources10 archives
Databases and archives Elymus elymoides's data was compiled from.
WikipediaWikimedia Foundation1 languages↗
GBIFGlobal Biodiversity Information Facility7 394 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics33 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources103 traits
Occurrence & distributionGBIF7 394 records
Environmental DNA1 datasets · 3 countries16 detections
DNA & barcodingBOLD · NCBI33 specimens
Genome at a glanceCCDB2n = 28
01Narrative
Elymus elymoides is a species of wild rye known by the common name squirreltail. This grass is native to most of North America west of the Mississippi River and occurs in a number of ecosystems, from the alpine zone to desert sage scrub to valley grassland. Elymus elymoides early-season spike close
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology5
Plant height0.46 m
⚠ sources differ — GIFT: 0.46 m · USDA: 0.457 m · TRY: 0.402 m
Plant height generative0.269 m
Seed mass4.25 mg
⚠ sources differ — TRY: 4.25 mg · GIFT: 2.93 mg
Seed mass max4.54 mg
Seed mass min2.71 mg
Life cycle & reproduction27
After harvest regrowth rateModerate
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typewind
Flower colouryellow
Flower conspicuousNo
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryLong
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Resprout abilityNo
Seed spread rateSlow
Seedling vigorMedium
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment25
Active growth periodSpring
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Growth formherb
Growth form USDABunch
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min12 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry26
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementLow
Fire resistantNo
Fire toleranceMedium
Frost free days min90 days
Leaf C:N ratio29.63 g/g
Leaf c420 mg/g
Leaf dry-matter content (LDMC)323 mg/g
Leaf n15.51 mg/g
Leaf p1.54 mg/g
Moisture useLow
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max16 in
Precipitation min5 in
Protein potentialMedium
Salinity toleranceLow
Shade toleranceHigh
Soil pH max8.4 pH
Soil pH min6 pH
Specific leaf area (SLA)13.63 mm²/mg
Temperature min-43 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityField Collections Only
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound192 000 per lb
ToxicityNone
Veneer productNo
Other traits4
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
05DNA & barcoding33 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elymus elymoides has left across the world's sequence archives.
At a glance
DNA specimens33
Marker genes6
GenBank sequences10
eDNA detections16
Countries3
The DNA barcodea real sequence read deposited for this species
TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGCGCACGTGTCATCCAATCCGTCGGCGATGGCAC …
Elymus elymoides voucher ID:174322 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL6★rbcLa★trnL-F★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Elymus elymoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidypolyploid inferred
Chromosome records28–282n range28median28mode5records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 285×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-atlas-flowering-plants +1
CCDB · ipcn-api-dl — Dewey, D. R. 1982. Cytogenetics of Agropyron ferganense and its hybrids with six species of Agropyron, Elymus and Sitanion. Amer. J. Bot. 68: 216–225.
CCDB · ipcn-api-dl — Love, A. 1980. In IOPB chromosome number reports LXVI. Taxon 29: 166–169.
CCDB · book-ipcn67-71 — DEWEY, D. R. 1967. Synthetic hybrids of Elymus canadensis x Sitanion hystrix. Bot. Gaz. 128: 11-16.
CCDB · book-atlas-flowering-plants — Fo
CCDB · Cave1959 — Bowden 1959b
n 144×CCDB · book-ipcn67-71 · CCDB · Cave1962 · CCDB · Cave1963
CCDB · book-ipcn67-71 — DEWEY, D.R. 1968. synthetic hybrids of Agropyron dasystachum X Elymus glaucus and Sitanion hystrix. Bot. Gaz. 129: 309-315.
CCDB · book-ipcn67-71 — DEWEY, D.R. 1968. Synthetic hybrids of Agropyron caespitosum X Agropyron dasvstachum and Sitanion hystrix. Bot. Gaz. 129: 316-322.
CCDB · Cave1962 — Dewey & Holmgren 1962
CCDB · Cave1963 — Clausen et al. 1940
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type7 394 records
Wild obs. + sensor3 582
Museum / vouchered3 357
Other455
Origin
Native1 630
Range
Area of Occupancy AOO17 500 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 1 311≤1 km 172≤10 km 78>10 km 63
1 624 georeferenced · 1 958 without coordinates
Open the mapobservation + sensor3 582
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy65% within 1 km
≤100 m 239≤1 km 711≤10 km 441>10 km 71
1 462 georeferenced · 1 895 without coordinates
Open the institutions mapphysical evidence3 357
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions79 of 120 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Claremont, US | 293 |
| ASUlocation not on record | 254 |
| Davis, US | 193 |
| Riverside, US | 181 |
| Bronx, US | 177 |
| University of Stellenboschlocation not on record | 167 |
| Moscow, US | 160 |
| Denver, US | 145 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 128 |
| Logan, US | 108 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 99 |
| Corvallis, US | 90 |
| Flagstaff, US | 87 |
| Boise, US | 82 |
| Phoenix, US | 76 |
| Missoula, US | 75 |
| Santa Barbara, US | 63 |
| Albuquerque, US | 62 |
| Victoria, CA | 56 |
| EL PASO, US | 55 |
| Bozeman, US | 37 |
| Pocatello, US | 32 |
| Spearfish, US | 31 |
| Lubbock, US | 31 |
| Eastern Nevada Landscape Coalitionlocation not on record | 31 |
| WTUlocation not on record | 28 |
| Provo, US | 28 |
| Emporia, US | 26 |
| Austin, US | 25 |
| Tampa, US | 22 |
| San Diego, US | 22 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 22 |
| Durango, US | 20 |
| San Luis Obispo, US | 17 |
| Fredericton Stock Culture Collectionlocation not on record | 17 |
| Torreón, MX | 17 |
| US | 16 |
| Rocky Mountain Biological Laboratorylocation not on record | 16 |
| Saint Louis, US | 15 |
| San Angelo, US | 15 |
| Ashland, US | 14 |
| Chongqing Museumlocation not on record | 14 |
| CASlocation not on record | 14 |
| Pullman, US | 12 |
| Caldwell, US | 12 |
| University of Alberta Museumslocation not on record | 11 |
| DOI/NPS, Greenbelt Parklocation not on record | 10 |
| Severin-McDaniel Insect Collectionlocation not on record | 9 |
| Hermosillo, MX | 9 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 9 |
| Bandelier National Monumentlocation not on record | 8 |
| Canadian Department of Agriculturelocation not on record | 8 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 8 |
| Tempe, US | 8 |
| Fort Worth, US | 7 |
| USFSlocation not on record | 7 |
| Tacoma, US | 6 |
| Lincoln, US | 6 |
| Bureau of Land Managementlocation not on record | 6 |
| Truckee, US | 6 |
| US | 6 |
| Weber State Universitylocation not on record | 6 |
| The University of Arizonalocation not on record | 5 |
| Vancouver, CA | 5 |
| STNFlocation not on record | 5 |
| Pittsburg, US | 5 |
| Arcata, US | 5 |
| Kew, GB | 5 |
| Northridge, US | 4 |
| BClocation not on record | 4 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 4 |
| Wuzhou, CN | 4 |
| Grand Junction, US | 4 |
| GB | 3 |
| San Jose, US | 3 |
| Bureau of Land Management, Medford District Officelocation not on record | 3 |
| Mexico City, MX | 3 |
| China Agricultural Universitylocation not on record | 2 |
| Irvine, US | 2 |
| Yellowstone National Park Herbariumlocation not on record | 2 |
| Madison, US | 2 |
| VALElocation not on record | 2 |
| St. Paul, US | 2 |
| Karlsruhe, DE | 1 |
| Dresden, DE | 1 |
| Edmonton, CA | 1 |
| Brookings, US | 1 |
| Chapel Hill, US | 1 |
| Bend, US | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Görlitz, DE | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| LDlocation not on record | 1 |
| Wlocation not on record | 1 |
| Stephenville, US | 1 |
| Oskarshamn, SE | 1 |
| Berlin, DE | 1 |
| Orem, US | 1 |
| New Mexico State Universitylocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Chicago, US | 1 |
| Bloomington, US | 1 |
| Durham, US | 1 |
| Long Beach, US | 1 |
| San Bernardino, US | 1 |
| Taipei, TW | 1 |
| KNFSClocation not on record | 1 |
| Los Angeles, US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Durango, MX | 1 |
| Henderson, US | 1 |
| Burlington, US | 1 |
| BAYLUlocation not on record | 1 |
| INFlocation not on record | 1 |
| Clemson, US | 1 |
| La Paz, MX | 1 |
| MAlocation not on record | 1 |
| Santa Cruz, US | 1 |
| Ensenada, MX | 1 |
120 institutions · 3 326 of 3 357 vouchered records shown · 29 without an institution code
09Environmental DNA16 detections
Where the DNA of Elymus elymoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map3 countries0
Chaparral with Adenostoma fasciculatum, Aden…Idaho Fescue/Bearded Wheatgrass-Sticky Geran…Growing off side of trailWet forest, subalpine fir/Globe huckleberry-…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.6 °C 8.40–21.1
Seasonal swing summer↔winter22.4 °C
Max temp (day)20.0 °C 14.8–27.7
Min temp (night)6.40 °C 2.70–14.1
Precipitation16.0 mm/mo 9.30–64.6
Air humidity46.4 % 43.9–55.8
Moisture balance-95.2 mm/mo -158–-49.3
Vapour deficit827 Pa 508–1,464
Wind speed3.60 m/s 1.90–4.50
Cloud cover25.5 % 24.1–34.7
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.