Elymus caninus
(L.) L. · speciesAt a glance
Occurrence records117 057
Data sources11
Biological traits39
DNA specimens42
eDNA detections19
Sources11 archives
Databases and archives Elymus caninus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility117 057 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics42 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources39 traits
Occurrence & distributionGBIF117 057 records
Environmental DNA1 datasets · 4 countries19 detections
DNA & barcodingBOLD · NCBI42 specimens
Genome at a glanceCCDB · GoaT9.1 Gbp
01Narrative
La graminia dei boschi è una pianta angiosperma monocotiledone appartenente alla famiglia delle Poacee.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass42.86 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 1 156 mm² · GIFT: 1 156 mm²
Plant height0.675 m
⚠ sources differ — GIFT: 0.675 m · LEDA: 0.675 m · TRY: 1 m
Plant height generative0.824 m
Plant height max2 m
Plant height min0.5 m
Seed length6.59 mm
Seed mass3.72 mg
⚠ sources differ — TRY: 3.72 mg · LEDA: 4.13 mg · GIFT: 3.8 mg
Seed mass max4.04 mg
Seed mass min2.16 mg
Life cycle & reproduction12
Deciduousnessevergreen
Dispersal typeanimal
Flowering endJul
Flowering startJun
Life formperennial
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number52.8
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: graminoid
Habitat GIFTforest
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry6
Leaf dry-matter content (LDMC)326 mg/g
⚠ sources differ — TRY: 326 mg/g · LEDA: 310 mg/g
Leaf n38 mg/g
Leaf p2.2 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)27.84 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
05DNA & barcoding42 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elymus caninus has left across the world's sequence archives.
At a glance
DNA specimens42
Marker genes6
GenBank sequences10
eDNA detections19
Countries5
The DNA barcodea real sequence read deposited for this species
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCAACCC …
Elymus caninus voucher Na-1175 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL3★rbcLa★ITS7★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Elymus caninus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size9 144 300 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Elymus caninus9.14 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy4× tetraploid · measured
Chromosome records14–422n range28median28mode87records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2884×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +17
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · ita-fl — DEWEY D.R. - 1969. Sinthetic hybrids of Agropyron Caespitosum x Agropyron spicalum, Agropyron Caninum, and Agropyron yezoense.. Bot. Gaz. , 130(2): 110-116.
CCDB · slov-fl — Holub J., Měsíček J. & Javůrková V., 1972: Annotated chromosome counts of Czechoslovak plants (31–60) (Materials for "Flóra ČSSR"– 3). - Folia Geobot. Phytotax. 7/2: 167-202.
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 77-103(1973).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4623
CCDB · poland — Pogan E., Wcis?o H., Izmai?ow R., Przywara L. et al. 1982 b. Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov. Ser. Bot. 24, 159-189.
CCDB · poland — Mizianty M., Frey L. and Szczepaniak M. 2001. The Agropyron-Elymus (Poaceae) complex in Poland: biosystematics. -In: L. Frey (ed.), Studies on grasses in Poland, pp. 25-77. W. Szafer Institute of Botany, Polish Academy of Sciences, Krakw.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1983. Chromosome numbers in flowering plants from Greece. Willdenowia 13: 329–333.
CCDB · ipcn-api-dl — Dewey, D. R. 1982. Cytogenetics of Agropyron ferganense and its hybrids with six species of Agropyron, Elymus and Sitanion. Amer. J. Bot. 68: 216–225.
CCDB · ipcn-api-dl — Pogan, E. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XV. Acta Biol. Cracov., Ser. Bot. 24: 91–126.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Salomon, B., R. v. Bothmer, J. L. Yang & B. Lu. 1988. Notes on perennial Triticeae -- species in northern Pakistan. Bot. Jahrb. Syst. 110: 7–15.
CCDB · ipcn-api-dl — Duckert-Henriod, M. M. 1991. Mediterranean chromosome number reports 1 (7--25). Fl. Medit. 1: 229–236.
CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II. Bot. Žhurn. (Moscow & Leningrad) 75: 118–120.
CCDB · ipcn-api-dl — Lu, B. r. & R. v. Bothmer. 1990. Genomic constitution of Elymus parviglumis and E. pseudonutans: Triticeae (Poaceae). Hereditas (Lund) 113: 109–119.
CCDB · ipcn-api-dl — Jensen, K. B. & S. L. Hatch. 1988. Cytology of Elymus panormitanus and its F1 hybrids with Pseudoroegneria spicata, Elymus caninus, and Elymus dentatus ssp. ugamicus. Genome 30: 879–884.
CCDB · ipcn-api-dl — Lu, B. r. & B. Salomon. 1993. Two new Tibetan species of Elymus (Poaceae: Triticeae) and their genomic relationships. Nordic J. Bot. 13: 353–367.
CCDB · ipcn-api-dl — Salomon, B. & B. r. Lu. 1992. Genomic groups, morphology, and sectional delimitation in Eurasian Elymus (Poaceae, Triticeae). Pl. Syst. Evol. 180: 1–13.
CCDB · ipcn-api-dl — Lu, B. r. & R. v. Bothmer. 1993. Meiotic analysis of Elymus caucasicus, E. longearistatus and their interspecific hybrids with twenty three Elymus species (Triticeae, Poaceae). Pl. Syst. Evol. 185: 35–53.
CCDB · ipcn-api-dl — Lu, B. r. 1993. Meiotic studies of Elymus nutans and E. jacquemontii (Poaceae, Triticeae) and their hybrids with Pseudoroegneria spicata and seventeen Elymus species. Pl. Syst. Evol. 186: 193–212.
CCDB · ipcn-api-dl — Lu, B. r. & R. v. Bothmer. 1992. Interspecific hybridization between Elymus himalayanus and E. schrenkianus, and other Elymus species (Triticeae: Poaceae). Genome 35: 230–237.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Salomon, B. & B. r. Lu. 1994. Genomic relationships between species of the Elymus semicostatus group and Elymus sensu lato (Poaceae). Pl. Syst. Evol. 191: 199–201.
CCDB · ipcn-api-dl — Lu, B. r., B. Salomon & R. v. Bothmer. 1995. Interspecific hybridizations with Elymus confusus and E. dolichatherus, and their genomic relationships (Poaceae: Triticeae). Pl. Syst. Evol. 197: 1–17.
CCDB · ipcn-api-dl — Mujeeb-Kazi, A., Q. Jahan & A. A. Vahidy. 1994. Application of a somatic and meiotic cytological technique to diverse plant genera and species in the Triticeae. Pakistan J. Bot. 26: 353–366.
CCDB · ipcn-api-dl — Zhang, X. Q., B. h. Wu, J. l. Yang, J. Yan & Y. L. Zheng. 1999. Biosystematic studies of Kengyilia stenachyra (Poaceae: Triticeae). Acta Bot. Yunnan. 21(4): 449–454.
CCDB · ipcn-api-dl — Zhang, X. Q., J. l. Yang & C. Yen. 1998. The genome constitution of Roegneria grandis (Poaceae, Triticeae). Pl. Syst. Evol. 209: 63–73.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Lu, B. r. & R. von\Bothmer. 1993. Genomic constitutions of four Chinese endemic Elymus species: E. brevipes, E. yangii, E. anthosachnoides, and E. altissimus (Triticeae, Poaceae). Genome 36: 863–876.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Lu, B. r., J. Yan & J. l. Yang. 1990. Cytological observations on Triticeae materials from Xinjiang, Qinghai and Sichuan. Acta Bot. Yunnan. 12: 57–66.
CCDB · ipcn-api-dl — Guzik, M. B. 1984. Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82–86.
CCDB · ipcn-api-dl — Jensen, K. B., K. Highnight & K. J. Wipff. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 20–21.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
+40 more references
2n 142×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · book-ipcn75-78 — Krog-ulevich 1978
2n 421×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Lu, B. r., J. Yan & J. l. Yang. 1990. Cytological observations on Triticeae materials from Xinjiang, Qinghai and Sichuan. Acta Bot. Yunnan. 12: 57–66.
n 423×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). II. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 153-205(1990).
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, A. Ortega, J. P. Carrasco, M. C. Viera, R. Torno & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura (Espana)---I. Bol. Soc. Brot., sér. 2 63: 29–66.
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990a). Contribución al conocimiento cariológico de las Poaceae en Extremadura (España). II. Bol. Soc. Brot. 63: 153-205.
n 141×CCDB · Cave1956
CCDB · Cave1956 — Stebbins & Snyder
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type117 057 records
Wild obs. + sensor106 898
Museum / vouchered9 135
Cultivated / captive66
Other958
Origin
Native12 143
Introduced3
Range
Area of Occupancy AOO212 168 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy44% within 1 km
≤100 m 22 474≤1 km 20 655≤10 km 52 918>10 km 968
97 015 georeferenced · 9 883 without coordinates
Open the mapobservation + sensor106 898
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy45% within 1 km
≤100 m 1 276≤1 km 1 727≤10 km 2 393>10 km 1 275
6 671 georeferenced · 2 464 without coordinates
Open the institutions mapphysical evidence9 135
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy57% within 1 km
≤1 km 16≤10 km 1>10 km 11
28 georeferenced · 38 without coordinates
Open the mapnot free-living66
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions71 of 154 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 320 |
| Helsinki, FI | 1 103 |
| Olocation not on record | 547 |
| DBF-NHMDlocation not on record | 515 |
| LDlocation not on record | 509 |
| Moscow State Universitylocation not on record | 508 |
| Oulu, FI | 349 |
| Trondheim, NO | 312 |
| BFLlocation not on record | 267 |
| TROMlocation not on record | 260 |
| South Kensington, GB | 252 |
| Bergen, NO | 174 |
| KMNlocation not on record | 150 |
| Salzburg, AT | 140 |
| BIO-UNIPIlocation not on record | 136 |
| SLU Artdatabankenlocation not on record | 129 |
| Tartu, EE | 127 |
| BRNUlocation not on record | 122 |
| Turku, FI | 122 |
| Oskarshamn, SE | 111 |
| MeiseBGlocation not on record | 97 |
| Kuopio, FI | 90 |
| BClocation not on record | 89 |
| BDBClocation not on record | 77 |
| Tallinn, EE | 63 |
| Garðabær, IS | 60 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 56 |
| Irkutsk State Universitylocation not on record | 48 |
| Entomological Society of Latvialocation not on record | 46 |
| MAlocation not on record | 42 |
| Jyväskylä, FI | 41 |
| Görlitz, DE | 38 |
| Barcelona, ES | 36 |
| Bern, CH | 35 |
| Wlocation not on record | 32 |
| València, ES | 31 |
| Provincia di Livornolocation not on record | 30 |
| TUR-Alocation not on record | 27 |
| Paris, FR | 27 |
| Kandalaksha State Nature Reservelocation not on record | 27 |
| 27 | |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 24 |
| Zürich, CH | 23 |
| Mlocation not on record | 21 |
| Uppsala, SE | 21 |
| Adam Mickiewicz University in Poznańlocation not on record | 21 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 20 |
| Zürich, CH | 17 |
| Berlin, DE | 16 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 15 |
| Madrid, ES | 14 |
| Salamanca, ES | 14 |
| UGentlocation not on record | 13 |
| Porvoo, FI | 12 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 12 |
| Pocatello, US | 11 |
| CJBGlocation not on record | 11 |
| Museo Achille Folettolocation not on record | 11 |
| Bronx, US | 11 |
| Porrentruy, CH | 11 |
| Karlsruhe, DE | 11 |
| GJOlocation not on record | 11 |
| SWE054location not on record | 11 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| Vitoria, ES | 9 |
| Frankfurt am Main | 9 |
| Stockholm, SE | 8 |
| Nijmegen, NL | 8 |
| Tromso University Museumlocation not on record | 8 |
| GZUlocation not on record | 8 |
| PrivatHerblocation not on record | 8 |
| Rovaniemi, FI | 7 |
| BSBIlocation not on record | 6 |
| nbflocation not on record | 6 |
| Uniwersytet Jagiellońskilocation not on record | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Auckland, NZ | 6 |
| Frauenfeld, CH | 6 |
| Forssa, FI | 5 |
| ESP004location not on record | 5 |
| Glarus, CH | 5 |
| Dresden, DE | 5 |
| Pamplona, ES | 4 |
| Urumqi, CN | 4 |
| Badajoz, ES | 4 |
| Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record | 4 |
| WTUlocation not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Jaén, ES | 4 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 4 |
| Dhaka, BD | 4 |
| HUN003location not on record | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Wuzhou, CN | 3 |
| Tacoma, US | 3 |
| Kew, GB | 2 |
| Tilburg, NL | 2 |
| H-Schuhwlocation not on record | 2 |
| Bloomington, US | 2 |
| Göteborg, SE | 2 |
| LfUlocation not on record | 2 |
| Philadelphia, US | 2 |
| GMBAlocation not on record | 2 |
| PRClocation not on record | 2 |
| Xiamen, CN | 2 |
| Namur, BE | 2 |
| CICYTEXlocation not on record | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Hazara Universitylocation not on record | 2 |
| Honolulu, US | 2 |
| University of Stellenboschlocation not on record | 2 |
| Fulda, DE | 2 |
| NMBU:MINAlocation not on record | 2 |
| BioFokuslocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| OLAlocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| Alicante, ES | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Umeå Universitylocation not on record | 1 |
| JP | 1 |
| H-AkrKGlocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Lausanne, CH | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| Sion, CH | 1 |
| St. Paul, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Ann Arbor, US | 1 |
| Metsähallituslocation not on record | 1 |
| Odawara, JP | 1 |
| Granada, ES | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Boise, US | 1 |
| Pretoria, ZA | 1 |
| Jurica-Suchy Nature Museumlocation not on record | 1 |
| Taipei, TW | 1 |
| Vancouver, CA | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 |
| Regensburgische Botanische Gesellschaftlocation not on record | 1 |
| Bourges, FR | 1 |
| ESP119location not on record | 1 |
| Flagstaff, US | 1 |
| IPE-CSIClocation not on record | 1 |
| NMWlocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
154 institutions · 8 773 of 9 135 vouchered records shown · 336 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Elymus caninus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map4 countries0
meadow
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.0 °C 8.10–17.1
Seasonal swing summer↔winter23.0 °C
Max temp (day)15.0 °C 10.3–21.0
Min temp (night)9.00 °C 4.30–13.2
Precipitation88.3 mm/mo 51.5–131
Air humidity63.9 % 60.1–67.1
Moisture balance3.90 mm/mo -45.0–47.5
Vapour deficit580 Pa 374–781
Wind speed3.50 m/s 2.70–4.80
Cloud cover58.3 % 42.3–65.8
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.