Eltroplectris calcarata

(Sw.) Garay & H.R.Sweet · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Eltroplectris

At a glance

Occurrence records256

Data sources7

Biological traits14

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Eltroplectris calcarata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility256 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF256 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Eltroplectris calcarata, the longclaw orchid, is a terrestrial species of orchid. It is native to Florida, Bahamas, Cayman Islands, Cuba, Hispaniola, Jamaica, Puerto Rico, Windward Islands, Trinidad, Suriname, Venezuela, Colombia, Peru, Brazil, and Paraguay.Kew World Checklist of Selected Plant FamiliesFlora of North America v 26, p 524, Eltroplectris calcarata (Swartz) Garay & H. R. Sweet, J. Arnold Arbor. 53: 390. 1972.de Fraga, C.N. & Peixoto, A.L. (2004). Florística e ecologia das Orchidaceae das restingas do estado do Espírito Santo. Rodriguésia; Revista do Instituto de Biologia Vegetal, Jardim Botânico e Estaçao Biologica do Itatiaya 55: 5-20.Toscano de Brito, A.L.V. & Cribb, P. (2006). Orquídeas da Chapada Diamantina: 1-400. Nova Fronteira, Brazil.Hokche, O., Berry, P.E. & Huber, O. (eds.) (2008). Nuevo Catálogo de la Flora Vascular de Venezuela: 1-859. Fundación Instituto Botánico de Venezuela.Dueñas Gómez, H.del C. & Fernández Alonso, J.L. (2009). Sinopsis de la subfamilia Spiranthoideae (Orchidaceae) en Colombia, parte II. Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales 33: 157-181.Dodson, C.H. & Luer, C.A. (2010). Flora of Ecuador 225(3): 1-438. Botanical Institute, University of Göteborg, Riksmuseum, Stockholm.Schinini, A. (2010). Orquídeas nativas del Paraguay. Rojasiana 9: 1-316.Acevedo-Rodríguez, P. & Strong, M.T. (2012). Catalogue of seed plants of the West Indies. Smithsonian Contributions to Botany 98: 1-1192.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max300 m

Elevation mean240 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTCampo Rupestre, Floresta Ciliar ou Galeria, Floresta Ombrófila (= Floresta Pluvial), Restinga

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eltroplectris calcarata has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences7

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF464940.1 ↗656 bpBrazil

ACGT

TCGAGACCCATAAAGGATTGGATGACCCTTGATAACCCGTGAACGTGTGGCAGCGCCAGCTGTCTATAAGCGCCATTCGCCTGGTGCTCC …

Eltroplectris calcarata voucher L. Guimaraes 199, SP internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type256 records

Wild obs. + sensor119

Museum / vouchered137

Origin

Native49

Range

Area of Occupancy AOO752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy9% within 1 km

≤100 m 8≤1 km 2≤10 km 3>10 km 104

117 georeferenced · 2 without coordinates

Open the mapobservation + sensor119

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 2>10 km 4

7 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UFESlocation not on record	18
Federal University of Espírito Santolocation not on record	15
Bronx, US	14
INMAlocation not on record	10
Universidade Federal do Rio Grande do Nortelocation not on record	9
Salvador, BR	8
Laboratorio de Ictiologialocation not on record	8
UFBAlocation not on record	6
JBRJlocation not on record	6
Chaguaramas, TT	5
Universidade Federal do Espírito Santolocation not on record	5
Blumenau, BR	4
San Jose State University, Museum of Birds and Mammalslocation not on record	4
Miami, US	3
VALElocation not on record	2
UFMGlocation not on record	2
Seropédica, BR	1
Cruz das Almas, BR	1
CEPLAClocation not on record	1
Paris, FR	1
UFRRJlocation not on record	1
Universidade Federal de Sergipe (UFS)location not on record	1
Santa Cruz de la Sierra, BO	1
La Paz, BO	1
Chongqing Museumlocation not on record	1
Santa Teresa, BR	1
Burlington, US	1
Museu Paraense Emílio Goeldilocation not on record	1
Saint Louis, US	1
UFPElocation not on record	1
IPA/SPlocation not on record	1

31 institutions · 134 of 137 vouchered records shown · 3 without an institution code

09Environmental DNA5 detections

Where the DNA of Eltroplectris calcarata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)