Elsinoe veneta

(Burkh.) Jenkins · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Myriangiales/Elsinoaceae/Elsinoe

At a glance

Occurrence records422

Data sources6

Biological traits0

DNA specimens0

eDNA detections3

Sources6 archives

Databases and archives Elsinoe veneta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility422 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF422 records

Environmental DNA3 datasets · 0 countries3 detections

DNA & barcodingNCBIsequences

01Narrative

Elsinoë veneta (Burkh.) Jenkins – gatunek grzybów z klasy Dothideomycetes. U malin i jeżyn wywołuje chorobę o nazwie antraknoza maliny i jeżyny.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elsinoe veneta has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSKX887297.1 ↗540 bp

ACGT

AGGTGAACCTGCGGAAGGATCATTAACGAGGAAGGGTTTCCGAAAGGAGCCCGATCTCCCCACCCTTTGCTGTTGCGAATCTGTTGCTTC …

Elsinoe veneta strain CBS 164.29 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type422 records

Wild obs. + sensor7

Museum / vouchered415

Range

Area of Occupancy AOO1 060 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy29% within 1 km

≤1 km 2≤10 km 5

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 20≤10 km 270>10 km 33

323 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence415

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	165
Bernard Price Institute for Palaeontological Researchlocation not on record	141
DPIlocation not on record	63
Auckland, NZ	11
Olocation not on record	11
Bronx, US	10
Pullman, US	8
Catholic University of Pekinglocation not on record	3
FLASlocation not on record	2
Tartu, EE	1

10 institutions · 415 of 415 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Elsinoe veneta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys3

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)