Elsinoe fawcettii

Bitanc. & Jenkins · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Myriangiales/Elsinoaceae/Elsinoe

At a glance

Occurrence records682

Data sources8

Biological traits0

DNA specimens79

eDNA detections80

Sources8 archives

Databases and archives Elsinoe fawcettii's data was compiled from.

GBIFGlobal Biodiversity Information Facility682 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI80 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics79 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF682 records

Environmental DNA2 datasets · 3 countries80 detections

DNA & barcodingBOLD · NCBI79 specimens

Genome at a glanceGoaT · NCBI≈27 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding79 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elsinoe fawcettii has left across the world's sequence archives.

At a glance

DNA specimens79

Marker genes2

GenBank sequences10

eDNA detections80

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMG956756.1 ↗603 bpUSA · 2014

ACGT

AAGGATCATTAACGAGGTAGGGCCTCCTTCGGGAGCCCGAACTCCCCACCCTTTGCTGTTGCGAATCACGTTGCTTCGGCGGGACCTCCC …

Elsinoe fawcettii voucher PK-MUR-L3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Elsinoe fawcettii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈26 655 928 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Elsinoe fawcettii0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type682 records

Wild obs. + sensor5

Museum / vouchered673

Cultivated / captive4

Range

Area of Occupancy AOO836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 1>10 km 3

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 12≤1 km 46≤10 km 146>10 km 260

464 georeferenced · 209 without coordinates

Open the institutions mapphysical evidence673

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	468
DPIlocation not on record	108
Auckland, NZ	35
FLASlocation not on record	5
Université de Montréal Biodiversity Centrelocation not on record	2
Bronx, US	1
Pullman, US	1
Catholic University of Pekinglocation not on record	1
ILLSlocation not on record	1

9 institutions · 622 of 673 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA80 detections

Where the DNA of Elsinoe fawcettii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found80

Studies independent surveys2

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 80 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 5.70–12.6

Seasonal swing summer↔winter27.3 °C

Max temp (day)16.4 °C 9.20–18.4

Min temp (night)7.40 °C 1.40–8.20

Precipitation112 mm/mo 79.6–130

Air humidity58.0 % 57.3–62.6

Moisture balance21.7 mm/mo -38.4–54.3

Vapour deficit690 Pa 357–733

Wind speed2.90 m/s 2.90–5.90

Cloud cover41.1 % 36.7–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)