Elsholtzia ciliata
(Thunb.) Hyl. · speciesAt a glance
Occurrence records6 577
Data sources14
Biological traits36
DNA specimens26
eDNA detections24
Sources14 archives
Databases and archives Elsholtzia ciliata's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility6 577 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources36 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS405 compounds
Occurrence & distributionGBIF6 577 records
Environmental DNA1 datasets · 1 countries24 detections
DNA & barcodingBOLD · NCBI26 specimens
Genome at a glanceCCDB2n = 16
01Narrative
Elsholtzia ciliata, commonly known as Vietnamese balm, xiang ru (香薷) or kinh giới in Vietnamese, is a plant native to Asia. In the US, it can go by the name Crested Late Summer Mint. In US Vietnamese grocery stores, it is called Kinh Gioi, Vietnamese Lemon Balm, or Vietnamese Lemon Mint.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology7
Plant height0.487 m
⚠ sources differ — GIFT: 0.487 m · LEDA: 0.375 m · TRY: 0.519 m
Plant height generative0.4 m
Plant height max0.5 m
Plant height min0.1 m
Seed mass0.215 mg
⚠ sources differ — TRY: 0.215 mg · LEDA: 0.311 mg · GIFT: 0.247 mg
Seed mass max0.23 mg
Seed mass min0.2 mg
Life cycle & reproduction12
Deciduousnessevergreen
Dispersal typeanimal
Flowering endSep
Flowering startJul
Life formannual
Life spanalways annual
⚠ sources differ — TRY: always annual · GIFT: annual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 700 m
Elevation mean2 000 m
Elevation min1 350 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTmountains, stony places
Mycorrhiza type0.00000000287
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits3
Diaspore typemericarp
Plant support typefree-standing
Shoot orientationerect
03Chemical composition405 compounds
Compounds documented for Elsholtzia ciliata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
💊 Medicinal use documented
Compound class profile5 classes
Acyclic monoterpenoids36
Flavones26
Menthane monoterpenoids $ Monocyclic monoterpenoids19
Cinnamic acids and derivatives13
Fatty alcohols11
Documented compounds405 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| EO | 4,000 ppm | DukesPhytochem | |
| 3-METHYL-2(3-METHYLBUT-2-ENOYL)-FURAN | 3,550 ppm | DukesPhytochem | |
| ELSCHOLTZIAKETONE | 1,250 ppm | DukesPhytochem | |
| HUMULENE | 55 ppm | DukesPhytochem | |
| CARYOPHYLLENE | 38 ppm | DukesPhytochem | |
| 3-METHYL-2(3-METHYLBUT-3-ENOYL)-FURAN | 36 ppm | DukesPhytochem | |
| 1-OCTEN-3-OL | 26 ppm | DukesPhytochem | |
| BOURBONENE | 11 ppm | DukesPhytochem | |
| (E,E)-ALPHA-FARNESENE | 8 ppm | DukesPhytochem |
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elsholtzia ciliata has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes5
GenBank sequences10
eDNA detections24
Countries4
The DNA barcodea real sequence read deposited for this species
ATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGACCGCGAA …
Elsholtzia ciliata isolate ITS11 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Elsholtzia ciliata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records16–322n range16median16mode19records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1614×CCDB · iapt · CCDB · poland · CCDB · ipcn-api-dl +1
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · iapt
CCDB · poland — Pogan E., Izmai?ow R. et al. 1983. Further studies in chromosome numbers of Polish Angiosperms. Part XVII. Acta Biol. Cracov. Ser. Bot. 25, 57-77.
CCDB · ipcn-api-dl — Pogan, E. 1983. Further studies in chromosome numbers of Polish angiosperms. Part XVII. Acta Biol. Cracov., Ser. Bot. 25: 57–77.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1990. Chromosome numbers in some representatives of the families Asclepiadaceae, Asteraceae, Boraginaceae, Chenopodiaceae, Lamiaceae, Oleaceae, Onagraceae, Scrophulariaceae, Solanaceae, Urticaceae from the Soviet Far East. Bot. Žhurn. (Moscow & Leningrad) 75: 1619–1622.
CCDB · ipcn-api-dl — Stepanov, N. V. 1994. Chromosome numbers of some higher plants taxa of the flora of Krasnoyarsk region. Bot. Žhurn. (Moscow & Leningrad) 79(2): 135–139.
CCDB · ipcn-api-dl — Probatova. 2006. Chromosome numbers of vascular plants from nature reserves of the Primorsky Territory and the Amur River basin. Bot. Žhurn. (Moscow & Leningrad) 91(7): 1117–1134.
CCDB · ipcn-api-dl — Rudyka, E. G. 1990. Chromosome numbers of vascular plants from the various regions of the USSR. Bot. Žhurn. (Moscow & Leningrad) 75: 1783–1786.
CCDB · book-indian_vol1 — Gill, L.S. 1971a
CCDB · iapt — IAPT/IOPB Chromosome Data 34
2n 184×CCDB · slov-fl · CCDB · ipcn-api-dl
CCDB · slov-fl — Uhríková A. & Májovský J., 1983: [Report], pp. 507. - In: Löve Á. (ed.), IOPB Chromosome number reports LXXX, Taxon 32 /3.
CCDB · ipcn-api-dl — Uhrikova, A. & J. Majovksy. 1983. In IOPB chromosome number reports LXXX. Taxon 32: 507.
CCDB · ipcn-api-dl — Zhang, Y. x., T. l. Shangyuan, J. a. Ping & G. h. Wang. 1993. Chromosome observation of 9 wild plant species from Shanxi. Guihaia 13: 159–163.
CCDB · ipcn-api-dl — Adamkiewiçz, E. & K. Bijok. 1980. Karyological investigations of Elsholtzia patrini (Lep.) Garcke. Zesz. Nauk. Wydz. Biol. Nauk Ziemi, Biol. 2: 77–80.
2n 321×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Nishikawa, T. 1985. Chromosome counts of flowering plants of Hokkaido (9). J. Hokkaido Univ. Educ., Sect. 2B 36: 25–40.
n 82×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — Gill, L. S. 1984. The incidence of polyploidy in the West-Himalayan Labiatae. Rev. Cytol. Biol. Vég., Bot. 7: 5–16.
CCDB · book-ipcn67-71 — GILL, L.S. 1971. Cytology of west-Himalayan Labiatae: tribe Satureineae. Caryologia 24: 203-207.
n 161×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 12
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type6 577 records
Wild obs. + sensor2 912
Museum / vouchered3 622
Cultivated / captive20
Other23
Origin
Native3
Introduced78
Range
Area of Occupancy AOO15 632 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 787≤1 km 185≤10 km 196>10 km 387
1 555 georeferenced · 1 357 without coordinates
Open the mapobservation + sensor2 912
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy26% within 1 km
≤100 m 20≤1 km 132≤10 km 393>10 km 43
588 georeferenced · 3 034 without coordinates
Open the institutions mapphysical evidence3 622
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 14>10 km 6
20 georeferenced
Open the mapnot free-living20
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions94 of 187 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 292 |
| Chengdu, CN | 251 |
| Sanda, JP | 213 |
| Yangling, CN | 203 |
| Odawara, JP | 184 |
| Central China Normal Universitylocation not on record | 166 |
| Moscow State Universitylocation not on record | 160 |
| Shinshu Universitylocation not on record | 138 |
| Kunming, CN | 130 |
| Nagano City, JP | 121 |
| Uniwersytet Wrocławskilocation not on record | 118 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 96 |
| LDlocation not on record | 81 |
| Wuhan, CN | 77 |
| Toyama, JP | 52 |
| Kochi, JP | 50 |
| Bando, JP | 50 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 48 |
| Fukushima Universitylocation not on record | 47 |
| Nagatoro-machi, Chichibu-gun, JP | 41 |
| Chiba, JP | 36 |
| KR | 35 |
| Tomioka, JP | 33 |
| Tsukuba, JP | 33 |
| Guangzhou, CN | 32 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 27 |
| Chengdu, CN | 27 |
| Guilin, CN | 25 |
| KURAlocation not on record | 25 |
| Yunnan Universitylocation not on record | 22 |
| Tokushima, JP | 21 |
| Sagamihara, JP | 21 |
| SXTCMlocation not on record | 21 |
| Seoul, KR | 19 |
| National Institute of Biological Resourceslocation not on record | 19 |
| Oskarshamn, SE | 19 |
| Sendai, JP | 18 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 17 |
| CASlocation not on record | 17 |
| JP | 16 |
| Osaka, JP | 16 |
| WNNUlocation not on record | 16 |
| Kawasaki Shi Tama Ku, JP | 15 |
| NSMKlocation not on record | 15 |
| GMBAlocation not on record | 15 |
| KOMlocation not on record | 14 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 13 |
| Kyoto Universitylocation not on record | 12 |
| Iwate Prefectural Museumlocation not on record | 12 |
| Kushiro City Museumlocation not on record | 11 |
| Korea National Arboretumlocation not on record | 11 |
| Cambridge, US | 10 |
| Hangzhou, CN | 10 |
| Akita Prefectural Museumlocation not on record | 9 |
| DMZ botanic gardenlocation not on record | 8 |
| Olocation not on record | 8 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| Berlin, DE | 7 |
| Wuhan, CN | 7 |
| Guiyang, CN | 7 |
| Shanxi Institute of Biologylocation not on record | 7 |
| Elocation not on record | 7 |
| Otaru, JP | 7 |
| Edinburgh, GB | 6 |
| Allentown, US | 6 |
| Philadelphia, US | 6 |
| Minia, EG | 6 |
| Madison, US | 6 |
| Changsha, CN | 6 |
| Xian, CN | 6 |
| Nishihara, JP | 6 |
| New Haven, US | 6 |
| Kathmandu, NP | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| Fort Worth, US | 5 |
| Kew, GB | 5 |
| Toyota city nature sanctuarylocation not on record | 5 |
| ENTClocation not on record | 5 |
| Philadelphia, US | 5 |
| Burlington, US | 5 |
| Lanzhou, CN | 5 |
| QAUlocation not on record | 5 |
| Görlitz, DE | 5 |
| Obihiro Centennial City Museumlocation not on record | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| Nanjing, CN | 5 |
| Tartu, EE | 5 |
| Chapel Hill, US | 4 |
| Hebei Normal Universitylocation not on record | 4 |
| Cambridge, US | 4 |
| Beijing Normal Universitylocation not on record | 4 |
| Shanghai, CN | 4 |
| Bergen, NO | 4 |
| Tianjin Natural History Museumlocation not on record | 4 |
| Jiangxi College of Educationlocation not on record | 3 |
| Hazara Universitylocation not on record | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 3 |
| KIRMlocation not on record | 3 |
| Taipei, TW | 3 |
| Ishikawa Museum of Natural Historylocation not on record | 3 |
| Saint Louis, US | 3 |
| Omachi Alpine Museumlocation not on record | 3 |
| Guangzhou, CN | 3 |
| Taipei, TW | 2 |
| Fujian Institute of Subtropical Botanylocation not on record | 2 |
| DNSMlocation not on record | 2 |
| Trondheim, NO | 2 |
| Zhuzhou, CN | 2 |
| Nishihara, JP | 2 |
| Hokkaido University Museumlocation not on record | 2 |
| West China Subalpine Botanical Gardenlocation not on record | 2 |
| Bronx, US | 2 |
| Gifu prefectural Museumlocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Taipei, TW | 2 |
| Paris, FR | 2 |
| KIWElocation not on record | 2 |
| Fairfax, US | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| Sapporo, JP | 2 |
| TUR-Alocation not on record | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Uppsala, SE | 2 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| Nanjing, CN | 2 |
| Dresden, DE | 2 |
| Kiritappu Wetland National Trustlocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Zhengzhou, CN | 2 |
| FFPRIlocation not on record | 2 |
| BFLlocation not on record | 2 |
| Wuzhou, CN | 1 |
| TROMlocation not on record | 1 |
| Philadelphia, US | 1 |
| Williamsburg, US | 1 |
| Guiyang, CN | 1 |
| Acadia Universitylocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Southwest Forestry Collegelocation not on record | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| XAJDlocation not on record | 1 |
| Taiyuan Normal Universitylocation not on record | 1 |
| Cambridge, US | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| GJOlocation not on record | 1 |
| BRNUlocation not on record | 1 |
| St. Paul, US | 1 |
| Awka, NG | 1 |
| Podgorica, ME | 1 |
| Shanxi Universitylocation not on record | 1 |
| Dekalb, US | 1 |
| Ann Arbor, US | 1 |
| SIHUlocation not on record | 1 |
| MeiseBGlocation not on record | 1 |
| 东北师范大学自然博物馆location not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Pullman, US | 1 |
| Due West, US | 1 |
| Bloomington, US | 1 |
| Norfolk, US | 1 |
| TAIElocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Bangkok, TH | 1 |
| Nanchong, CN | 1 |
| Elikins, US | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Saint John, CA | 1 |
| GAlocation not on record | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Davis, US | 1 |
| University of New Hampshirelocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Xining, CN | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| Urumqi, CN | 1 |
| UoB-IBlocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| EMTCMlocation not on record | 1 |
| Northridge, US | 1 |
187 institutions · 3 552 of 3 622 vouchered records shown · 58 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Elsholtzia ciliata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map1 country0
edge of lawn near dock at rivershoreIn flower bed.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.6 °C 12.6–12.6
Seasonal swing summer↔winter27.3 °C
Max temp (day)16.4 °C
Min temp (night)7.40 °C
Precipitation112 mm/mo
Air humidity58.0 %
Moisture balance21.7 mm/mo
Vapour deficit690 Pa
Wind speed2.90 m/s
Cloud cover41.1 %
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.