Ellisiophyllum pinnatum

(Wall. ex Benth.) Makino · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Ellisiophyllum

At a glance

Occurrence records1 211

Data sources9

Biological traits16

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Ellisiophyllum pinnatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 211 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources16 traits

Chemical compositionNPASS5 compounds

Occurrence & distributionGBIF1 211 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Ellisiophyllum pinnatum – gatunek roślin z rodziny babkowatych. Reprezentuje monotypowy rodzaj Ellisiophyllum. Zasięg gatunku obejmuje wschodnią Azję od Nepalu, poprzez Chiny do Japonii, Filipin i Nowej Gwinei. Występuje na obszarach górskich do 2500 m n.p.m. Rośnie nad strumieniami, na łąkach i w widnych lasach.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology6

Fruit length4.5 mm

Fruit length max5 mm

Fruit length min4 mm

Leaf length35 mm

Leaf length max50 mm

Leaf length min20 mm

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Habitat & environment8

Climatesubtropical

Climberself-supporting

Elevation max3 100 m

Elevation mean2 000 m

Elevation min1 500 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition5 compounds

Compounds documented for Ellisiophyllum pinnatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Carotenoids (C40, β-ε)2

Simple phenolic acids1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
2-Furancarboxylic acid	present	NPASS
4-Hydroxyphenylacetic acid	present	NPASS
Chrysanthemaxanthin	present	NPASS
Flavoxanthin	present	NPASS
Hydroquinone	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ellisiophyllum pinnatum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences7

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAY492103.1 ↗652 bp

ACGT

GTACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCACAGCAGACCGCGAACATGTGTATAACCATGCGGGCGCG …

Ellisiophyllum pinnatum 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ellisiophyllum pinnatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidypolyploid inferred

Chromosome records16–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-ipcn66 · CCDB · book-ipcn73-74

CCDB · book-ipcn66 — Kurosawa 1966

CCDB · book-ipcn73-74 — KUROSAWA, s. 1971. Cytological studies on some eastern Himalayan plants and their related species. The Flora of eastern Himalaya. Second report. pp. 355-364. Univ. Tokyo Press.

2n 161×CCDB · book-fedorov

CCDB · book-fedorov — Borgmann 1964

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.996 ↗

08Occurrence & distribution

Record type1 211 records

Wild obs. + sensor1 018

Museum / vouchered189

Cultivated / captive1

Other3

Origin

Native5

Introduced1

Range

Area of Occupancy AOO1 128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 471≤1 km 121≤10 km 38>10 km 14

644 georeferenced · 374 without coordinates

Open the mapobservation + sensor1 018

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 187 without coordinates

Open the institutions mapphysical evidence189

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	55
Chengdu, CN	29
Taipei, TW	19
Beijing, CN	18
Taipei, TW	10
Wuhan, CN	8
TAIElocation not on record	5
Guangzhou, CN	5
Seoul, KR	4
Cambridge, US	4
湖北神农架林区标本馆location not on record	4
Kew, GB	3
Nanjing, CN	3
South Kensington, GB	2
Strecker Museum, Baylor Universitylocation not on record	2
Nanjing, CN	2
CASlocation not on record	2
Saint Louis, US	1
Yangling, CN	1
Chicago, US	1
Central China Normal Universitylocation not on record	1
Burlington, US	1
Beijing Normal Universitylocation not on record	1
Shanghai Chenshan Botanical Gardenlocation not on record	1
Edinburgh, GB	1

25 institutions · 183 of 189 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Ellisiophyllum pinnatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 20.2–20.2

Seasonal swing summer↔winter14.1 °C

Max temp (day)22.4 °C

Min temp (night)15.8 °C

Precipitation600 mm/mo

Air humidity69.3 %

Moisture balance495 mm/mo

Vapour deficit728 Pa

Wind speed1.00 m/s

Cloud cover27.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ellisiophyllum pinnatum

At a glance

Sources9 archives

Size & morphology6

Life cycle & reproduction2

Habitat & environment8

Compound class profile2 classes

Documented compounds5 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 211 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 211 records