Elingamita johnsonii

Baylis · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Primulaceae/Elingamita

At a glance

Occurrence records62

Data sources11

Biological traits9

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Elingamita johnsonii's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF62 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 46

01Narrative

Elingamita is a genus in the plant family Primulaceae. It consists of a single species, Elingamita johnsonii, a tree or shrub endemic to the Three Kings Islands approximately 55 km north of the North Island of New Zealand. The entire world natural population of the tree is confined to a small rocky island and two nearby islets, and thus is vulnerable to destruction by fire or other unforeseen events. Elingamita johnsonii grows as a shrub or small tree in pohutukawa (Metrosideros excelsa) forest and coastal scrub on West island. It also occurs on two rocky islets of the Princes Group; on one of these islets, Hinemoa Rock, it grows as an emergent canopy tree in exposed places. The relationship of Elingamita to other genera of the Primulaceae (formerly Myrsinaceae) remains to be properly established. Discovered in 1950, Elingamita johnsonii takes its name from the steamer Elingamite, which was wrecked on West Island in 1902. The natural range is currently free of rodents, but the fruit is known to be very palatable to rats. Ohau/West Island, From the West

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height8 m

Seed mass556 mg

Seed mass max556 mg

Seed mass min556 mg

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Habitat & environment3

Climatesubtropical

Growth formtree

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elingamita johnsonii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLZ83145.1 ↗1 392 bp

ACGT

TAAAGCAGGTACTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGTAACCAAGGATACTGATATATT …

E.johnsoni rbcL gene

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Elingamita johnsonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 46 n = 23

Chromosome records46–462n range46median46mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 462×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — Dawson, M. I. 1995. Contributions to a chromosome atlas of the New Zealand flora---34. Miscellaneous species. New Zealand J. Bot. 33: 477–487.

07Deep time~23.8 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin23.8 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type62 records

Wild obs. + sensor6

Museum / vouchered56

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy17% within 1 km

≤1 km 1>10 km 5

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	24
Christchurch, NZ	19
Wellington, NZ	9
Rotorua, NZ	3
Hobart, AU	1

5 institutions · 56 of 56 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Elingamita johnsonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)