Eleusine indica
(L.) Gaertn. · speciesAt a glance
Occurrence records33 371
Data sources15
Biological traits80
DNA specimens48
eDNA detections79
Sources15 archives
Databases and archives Eleusine indica's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility33 315 records↗
OBISOcean Biodiversity Information System56 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI79 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics48 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources80 traits
Chemical compositionLOTUS · NPASS24 compounds
Occurrence & distributionGBIF · OBIS33 371 records
Environmental DNA2 datasets · 12 countries79 detections
DNA & barcodingBOLD · NCBI48 specimens
Genome at a glanceCCDB · GIFT · GoaT1.1 Gbp
01Narrative
Eleusine indica, l'éleusine des Indes ou « pied-de-poule », est une espèce de plantes monocotylédones de la famille des Poaceae (graminées). C'est une herbe annuelle de petite taille, présente dans les régions tropicales et subtropicales dans la zone des 50 degrés de latitude. Elle se comporte comme une espèce envahissante dans certaines régions. Eleusine indica est étroitement apparentée à Eleusine coracana, espèce allotétraploïde, dont elle est probablement un ancêtre. Les graines d'Eleusine indica sont comestibles et sont parfois utilisées comme aliment de famine, mais les rendements sont faibles. C'est une mauvaise herbe importante dans les champs cultivées, ainsi que dans les pelouses et terrains de golf. Elle prospère dans les zones perturbées aux sols compacts et bien ensoleillées. Cette plante basse est capable de produire des graines, même lorsqu'elle est tondue à ras. Les méthodes de lutte font appel au travail du sol (labour) et à des traitements herbicides. Certaines populations ont développé une résistance à des herbicides, notamment ceux à base de glyphosate.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology31
Fruit length1.15 mm
⚠ sources differ — AusTraits: 1.15 mm · GIFT: 1.4 mm
Fruit length max2 mm
Fruit length min1 mm
Fruit width0.875 mm
Fruit width max0.95 mm
Fruit width min0.8 mm
Inflorescence length max15 cm
Inflorescence length min3.5 cm
Leaf length250 mm
Leaf length max300 mm
Leaf length min100 mm
Leaf mass11.83 mg
Leaf size709 mm²
⚠ sources differ — AusTraits: 709 mm² · LEDA: 288 mm² · GIFT: 288 mm²
Leaf width6 mm
⚠ sources differ — AusTraits: 6 mm · GIFT: 5 mm
Leaf width max10 mm
Leaf width min3 mm
Plant height0.35 m
⚠ sources differ — GIFT: 0.35 m · AusTraits: 0.9 m · LEDA: 0.1 m · TRY: 0.23 m
Plant height generative0.107 m
Plant height max0.9 m
Plant height min0 m
Seed length1.5 mm
⚠ sources differ — AusTraits: 1.5 mm · GIFT: 1.4 mm
Seed length max1.4 mm
Seed mass0.392 mg
⚠ sources differ — TRY: 0.392 mg · AusTraits: 0.32 mg · LEDA: 0.432 mg · GIFT: 0.416 mg
Seed mass max0.71 mg
Seed mass min0.2 mg
Seed volume0.4 mm³
Seed volume max0.4 mm³
Seed volume min0.4 mm³
Seed width0.9 mm
Seed width max0.9 mm
Seed width min0.9 mm
Life cycle & reproduction18
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typewater
⚠ sources differ — AusTraits: hydrochory · LEDA: endozoochor · GIFT: unspecialized
Flower colourpurple
Flower length max3.5 mm
Flower length min3 mm
Flowering endDec
Flowering startJul
Flowering timeyynnnnnnnnny
Life formannual or perennial
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual perennial · LEDA: summer annuals · GIFT: annual
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number500
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max3 000 m
Elevation mean500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
⚠ sources differ — AusTraits: caryopsis · GIFT: achene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFTroadsides
Leaf compoundnesssimple
Mycorrhiza typearbuscular
Succulenceno
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio14.31 g/g
Leaf c370 mg/g
Leaf dry-matter content (LDMC)233 mg/g
Leaf n26.56 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Specific leaf area (SLA)20.53 mm²/mg
⚠ sources differ — TRY: 20.53 mm²/mg · LEDA: 24.2 mm²/mg · GIFT: 24.2 mm²/mg
Other traits7
Diaspore typefruit
Fruit height0.875 mm
Fruit height max0.95 mm
Fruit height min0.95 mm
Inflorescencespike
Seeds per fruit101-1000
Shoot orientationascending
03Chemical composition24 compounds
Compounds documented for Eleusine indica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols5
Cycloartane triterpenoids4
Cycloabietane diterpenoids3
Flavones2
Furanoabietane diterpenoids1
Documented compounds24 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,2S,5S,7R,8S,17S)-2,7,14-trimethyl-16-oxapentacyclo[9.7.0.02,8.05,7.013,17]octadeca-10,13-diene-12,15-dione | present | NPASS | |
| (1S,2R,5R,7S,8R,11S,17R)-11-hydroxy-2,7,14-trimethyl-16-oxapentacyclo[9.7.0.02,8.05,7.013,17]octadec-13-ene-12,15-dione | present | NPASS | |
| (1S,2R,5R,7S,8R,12R,15S,16R,17R)-17-hydroxy-2,7,15-trimethyl-13-oxapentacyclo[9.7.0.02,8.05,7.012,16]octadec-10-en-14-one | present | NPASS | |
| (1S,2R,5R,7S,8R,13R,14R,17R)-2,7,14-trimethyl-16-oxapentacyclo[9.7.0.02,8.05,7.013,17]octadec-10-ene-12,15-dione | present | NPASS | |
| (24R)-9,19-cycloart-25-ene-3beta,24-diol | present | NPASS | |
| (2S,5S,7R,8S,10R,17S)-10-hydroxy-2,7,14-trimethyl-16-oxapentacyclo[9.7.0.02,8.05,7.013,17]octadeca-1(11),13-diene-12,15-dione | present | NPASS | |
| (2S,5S,7R,8S,17S)-2,7,14-trimethyl-16-oxapentacyclo[9.7.0.02,8.05,7.013,17]octadeca-1(11),13-diene-12,15-dione | present | NPASS | |
| 24-Methylenecycloartan-3-ol | present | NPASS | |
| 24-Methylenecycloartanone | present | NPASS | |
| [(1S,3R,6S,8R,11S,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methyl-5-methylideneheptan-2-yl]-6-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl] (2E,4E)-deca-2,4-dienoate | present | NPASS |
05DNA & barcoding48 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleusine indica has left across the world's sequence archives.
At a glance
DNA specimens48
Marker genes8
GenBank sequences10
eDNA detections79
Countries12
The DNA barcodea real sequence read deposited for this species
GTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTTTTGGTCGAGGGCACGTCTGCCTGGGCGT …
Eleusine indica voucher MC131 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL2★rbcLa★trnL-F★ITS8★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Eleusine indica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 075 800 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Eleusine indica1.08 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–542n range18median18mode61records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1849×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · nw-europe-fl +13
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iber-fl — Contribuci a la biosistemtica de les espcies catalanas del genere Eleusine (Pocies). Llaurad Miravall, M.Folia Bot. Misc.4: 37-47(1984).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4666
CCDB · ipcn-api-dl — Bhattacharyya, B. 1973. Chromosome analysis of some Indian members of the tribe Eragrosteae. J. Cytol. Genet. 7–8: 161–164.
CCDB · ipcn-api-dl — Hiremath, S. C. & M. S. Chennaveeraiah. 1982. Cytogenetical studies in wild and cultivated species of Eleusine (Gramineae). Caryologia 35: 57–69.
CCDB · ipcn-api-dl — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 140–143.
CCDB · ipcn-api-dl — Hiremath, S. C. & S. S. Salimath. 1991. Quantitative nuclear DNA changes in Eleusine (Gramineae). Pl. Syst. Evol. 178: 225–233.
CCDB · ipcn-api-dl — Salimath, S. S., S. C. Hiremath & H. N. Murthy. 1995. Genome differentiation patterns in diploid species of Eleusine (Poaceae). Hereditas (Lund) 122: 189–195.
CCDB · ipcn-api-dl — Mysore, K. S. & V. Baird. 1997. Nuclear DNA content in species of Eleusine (Gramineae): a critical re-evaluation using laser flow cytometry. Pl. Syst. Evol. 207: 1–11.
CCDB · ipcn-api-dl — Yang, D. k. 1998. Karyotype studies of four herbaceous species from Shandong. Guihaia 18(1): 41–44.
CCDB · ipcn-api-dl — Bisht, M. S. & Y. MUKAI. 2000. Mapping of rDNA on the chromosome of Eleusine species by fluorescence in situ hybridization. Genes Genet. Systems 75: 343–348.
CCDB · ipcn-api-dl — DUJARDIN, M. 1979. Additional chromosome numbers and meiotic behaviour in tropical African grasses from western Zaire. Canad. J. Bot. 57: 864–876.
CCDB · ipcn-api-dl — Bisht, M. S. & Y. MUKAI. 2001. Identification of genome donors to the wild species of finger millet, Eleusine africana by genomic in situ hybridization. Breed. Sci. 51: 263–269.
CCDB · ipcn-api-dl — Devarumath, R. M., S. C. Hiremath, S. R. Rao, A. Kumar & S. Bewal. 2005. Genome analysis of finger millet E. coracana by interspecific hybridization among diploid wild species of Eleusine (Poaceae). Cytologia 70: 427–434.
CCDB · ipcn-api-dl — Mallikharjun. 2005. Genome interrelationship in the genus Eleusine (Poaceae) as revealed through heteroploid crosses. Caryologia 58(4): 300–307.
CCDB · ipcn-api-dl — Renard, R., J. Lambinon, M. Reekmans, P. v. Veken & M. Govaert. 1983. Nombres chromosomiques de quelques Angiospermes du Rwanda, du Burundi et du Kenya. Bull. Jard. Bot. Nat. Belg. 53: 342–371.
CCDB · book-ipcn66 — Singh & Godward 1960; Harvey 1966a
CCDB · book-ipcn72 — HSU, C-C. 1972. Preliminary chromosome studies on the vascular plants of Taiwan (V). Cytotaxonomy on some monocotyledons. Taiwania 17: 48-65.
CCDB · book-ipcn67-71 — BAQUAR, s.R., & M. SAEED. 1969. Chromosome studies and polyploidy analysis in grasses of West Pakistan. I. Caryologia 22: 103-111.
CCDB · book-ipcn67-71 — BAQUAR, S.R . & M. SAEED. 1969. Chromosome ~tudies and polyploidy analysis in grasses of West Pakistan I. Caryologia 22: 103-111.
CCDB · book-ipcn75-78 — 27
CCDB · book-ipcn73-74 — CHRISTOPHER, J., & A. ABRAHAM. 1974. Studies on the cytology and phylogeny of South Indian grasses. II. Sub-family Eragrostoideae. Cytologia 39: 561-571.
CCDB · book-ipcn73-74 — GOULD, F.W., & T.R. SODERSTROM. 1974. Chromosome numbers of some Ceylon grasses. Canad. J. Bot. 52: 1075-1090.
CCDB · book-ipcn73-74 — SINHA, R.R.P., & R.P. JHA. 1972. Cytological studies in some grasses' of Bihar. Proc. Indian Sci. Congr. Assoc. 59( III): '352-353.
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov) ; Krishnas- wamy, N. 1941, 1951 ; Ono, H. & Tateoka, T. 1953 ; Tateoka, T. 1954 ; Sharma, A.K. & De, D.N. 1956b; Chandola, R.P. !959; Sharma, A.K. & Jhuri, L. 1959 ; Singh, D.N. & Godward, M.B E. 196G; Chen, C.C. & Hsu, C.C. 1962; Gupta, P.K. 1963b, 1971 ; Larsen, K. 1963b ; Singh, D.N. 1965b ; Mehra, P.N. et a/. 1968 ; Narayan, K.N. & Sindhe, A.N.R. 1968 ; Baquar, S.R. & Saeed, M. 1969 ; Malik, C.P. & Mary, T.N. 197Gb ; Hsu, C.-C. 1972; Sinha, R.R.P. & Jha, R.P. 1972 ; Chennaveeraiah, M.S. & Hiremath, S.C. 1974; Chiristopher, J. & Abraham, A. 1974 ; Gould, F.W. & Soderstrom, T.R. 1974; Olorode, O. 1974b ; Mehra, P.N. & Sharma, M.L. 1975d, f; Sarkar, A.K. et al. 1976 ; Sindhe, A.N.R. 1977 ; Dujardin, M. 1977a, b-
CCDB · eflora
CCDB · Cave1956 — Sharma & De
CCDB · Cave1959 — Sharma & Jhuri 1959; Ohandola 1959
CCDB · Cave1963 — Larsen 1963b; Mehra 1963
CCDB · CromoCat 2015 — Llauradó Miravall, M. (1984b). Contribució a la biosistemàtica de les espècies catalanes del gènere Eleusine (Poàcies). Folia Bot. Misc. 4: 37-47.
CCDB · CromoCat 2015 — Bhattacharyya, B. (1973). Chromosome analysis of some Indian members of the tribe Eragrosteae. Journal of Cytology and Genetics 7-8: 161-164
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1986). SOCGI plant chromosome number reports -- IV J. Cytol. Genet. 21: 152-154
CCDB · CromoCat 2015 — Bisht, M. S. & Mukai, Y. (2000). Mapping of rDNA on the chromosome of Eleusine species by fluorescence in situ hybridization Genes and Genetic Systems 75: 343-348
CCDB · CromoCat 2015 — Dujardin, M. (1979b). Additional chromosome numbers and meiotic behaviour in tropical African grasses from western Zaire. Canadian Journal of Botany 57: 864-876.
CCDB · CromoCat 2015 — Faruqi, S. A., Quraish, H. B. & Inamuddin, M. (1987). Studies in Libyan grasses X. Chromosome number and some interesting features Annali di Botanica 45: 75-102
CCDB · CromoCat 2015 — Hiremath, B. S. & Chennaveeraiah, M. S. (1982). Cytogenetical studies in wild and cultivated species of Eleusine (Gramineae). Caryologia 35: 57-69
CCDB · CromoCat 2015 — Hiremath, S. C. & Salimath, S. S. (1991). Quantitative nuclear DNA changes in Eleusine (Gramineae) Plant Systematics and Evolution 178: 225-233
CCDB · CromoCat 2015 — Koul, K. K. & Gohil, R. N. (1988). SOCGI plant chromosome number reports -- VI Journal of Cytology and Genetics 23: 38-52
CCDB · CromoCat 2015 — Mehra, P. N. (1982). Cytology of East Indian grasses
CCDB · CromoCat 2015 — Moinuddin, M., A. A. Vahidy & S. I. Ali (1994). Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan Ann. Missouri Bot. Gard. 81(4): 784-791
+8 more references
2n 369×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · CCDB · book-atlas-flowering-plants +3
CCDB · ipcn-api-dl — Wet, J. M. J. d. 1954. Chromosome numbers of a few South African grasses. Cytologia 19: 97–103.
CCDB · book-indian_vol2 — Moffett, A.A. & Hurcombe, R. 1949; Go\lld, F.W. & Soderstrom, T.R. 1967; Subramanyam, K. & Kamble, N.P. 1967
CCDB · book-atlas-flowering-plants — Moffett & H. 1949
CCDB · Cave1956supp — de Wet 1954
CCDB · CromoCat 2015 — Subramanyam, K. & N. P. Kamble. (1967). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XII]. Taxon 16(4): 341-350.
CCDB · CromoCat 2015 — Gould, F. W. & Soderstrom, T. R. (1967). Chromosome numbers of tropical American grasses. Amer. J. Bot. 54: 676-683.
CCDB · CromoCat 2015 — Moffett, A. A. & R. Hurcombe. (1949). Chromosome numbers of South African grasses. Heredity 3: 369-373.
CCDB · CromoCat 2015 — Wet, J. M. J., de. (1954). Chromosome numbers of a few South African grasses. Cytologia 19: 97-103.
GIFT · GIFT (floras)
2n 202×GoaT · Kew Plant DNA C-values Database · CCDB · kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · kew — Bennett MD, Smith JB. 1976. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 274: 227-274.
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kaur, H, Gupta, R. C & Kumari, S. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1789
2n 91×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Sharma, C.B., B.N. Behera & S.K. Dash. (1978). A cytological study of some grasses from Orissa, an eastern coastal belt of India. Proceedings of the Indian Academy of Sciences 87B 11: 355-360.
2n 541×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 933×CCDB · iber-fl · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +6
CCDB · iber-fl — Contribuci a la biosistemtica de les espcies catalanas del genere Eleusine (Pocies). Llaurad Miravall, M.Folia Bot. Misc.4: 37-47(1984).
CCDB · book-ipcn65 — D. N. Singh 1965
CCDB · ipcn-api-dl — Sharma, C. B., B. N. Behera & S. K. Dash. 1978. A cytological study of some grasses from Orissa, an eastern coastal belt of India. Proc. Indian Acad. Sci. 87B 11: 355–360.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1986. SOCGI plant chromosome number reports -- IV. J. Cytol. Genet. 21: 152–154.
CCDB · ipcn-api-dl — Koul, K. K. & R. N. Gohil. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Faruqi, S. A., H. B. Quraish & M. Inamuddin. 1987. Studies in Libyan grasses X. Chromosome number and some interesting features. Ann. Bot. (Rome) 45: 75–102.
CCDB · ipcn-api-dl — Bir, S. S. & H. S. Chauhan. 1990. SOCGI plant chromosome number reports---X. J. Cytol. Genet. 25: 322–323.
CCDB · ipcn-api-dl — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 140–143.
CCDB · ipcn-api-dl — DUJARDIN, M. 1979. Additional chromosome numbers and meiotic behaviour in tropical African grasses from western Zaire. Canad. J. Bot. 57: 864–876.
CCDB · book-ipcn66 — Singh & Godward 1960; Harvey 1966a
CCDB · book-ipcn72 — GUPTA, P.K. 1971. Cytological investigations in some North Indian grasses. Genet. Iber. 23: 183-198.
CCDB · book-ipcn67-71 — MALIK, C.P., & T.N. MARY. 1970. In IOPB chromosome number reports XXVII. Taxon 19: 437-442:"
CCDB · book-ipcn75-78 — Mehra & Sharma 1975c
CCDB · book-ipcn75-78 — Mehra & Sharma 1975e
CCDB · book-ipcn75-78 — 27
CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — CHRISTOPHER, J., & A. ABRAHAM. 1974. Studies on the cytology and phylogeny of South Indian grasses. II. Sub-family Eragrostoideae. Cytologia 39: 561-571.
CCDB · book-ipcn73-74 — OLORODE, o. 1974. Chromosome counts in some Nigerian grasses. Cytologia 39: 429-435.
CCDB · CromoCat 2015 — Llauradó Miravall, M. (1984b). Contribució a la biosistemàtica de les espècies catalanes del gènere Eleusine (Poàcies). Folia Bot. Misc. 4: 37-47.
CCDB · CromoCat 2015 — Bhattacharyya, B. (1973). Chromosome analysis of some Indian members of the tribe Eragrosteae. Journal of Cytology and Genetics 7-8: 161-164
CCDB · CromoCat 2015 — Bir, S. S. & Chauhan, H. S. (1990a). SOCGI plant chromosome number reports-X J. Cytol. Genet. 25:147-148
CCDB · CromoCat 2015 — Bir, S. S. & Chauhan, H. S. (1990b). SOCGI plant chromosome number reports-IX J. Cytol. Genet. 25: 322-323
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1986). SOCGI plant chromosome number reports -- IV J. Cytol. Genet. 21: 152-154
CCDB · CromoCat 2015 — Dujardin, M. (1979a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIII]. Taxon 28(1, 2/3): 275-276.
CCDB · CromoCat 2015 — Dujardin, M. (1979b). Additional chromosome numbers and meiotic behaviour in tropical African grasses from western Zaire. Canadian Journal of Botany 57: 864-876.
CCDB · CromoCat 2015 — Faruqi, S. A., Quraish, H. B. & Inamuddin, M. (1987). Studies in Libyan grasses X. Chromosome number and some interesting features Annali di Botanica 45: 75-102
CCDB · CromoCat 2015 — Koul, K. K. & Gohil, R. N. (1988). SOCGI plant chromosome number reports -- VI Journal of Cytology and Genetics 23: 38-52
CCDB · CromoCat 2015 — Malik, C. P. & Mary, T. N. (1970). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXVII]. Taxon 19(3): 439.
CCDB · CromoCat 2015 — Mehra, P. N. & M. L. Sharma. (1975b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIX]. Taxon 24(4): 501.
CCDB · CromoCat 2015 — Mehra, P. N. (1982). Cytology of East Indian grasses
CCDB · CromoCat 2015 — Moinuddin, M., A. A. Vahidy & S. I. Ali (1994). Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan Ann. Missouri Bot. Gard. 81(4): 784-791
CCDB · CromoCat 2015 — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh (1990). SOCGI plant chromosome number reports---IX J. Cytol. Genet. 25: 140-143
n 185×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — GOULD, F. W., & T. R. SODERSTROM. 1967. Chromosome numbers of tropical American grasses. Arn. Jour. Bot. 54: 676-683.
CCDB · book-ipcn67-71 — SUBRAMANYAM, K., & N. P. KAMBLE. 1967. In IOPB chromosome number reports XII. Taxon 16: 341-350.
CCDB · CromoCat 2015 — Bir, S. S. & Chauhan, H. S. (1990a). SOCGI plant chromosome number reports-X J. Cytol. Genet. 25:147-148
CCDB · CromoCat 2015 — Dujardin, M. (1979a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIII]. Taxon 28(1, 2/3): 275-276.
CCDB · CromoCat 2015 — Subramanyam, K. & N. P. Kamble. (1967). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XII]. Taxon 16(4): 341-350.
n 142×CCDB · iapt · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · CromoCat 2015 — Kaur, H, Gupta, R. C & Kumari, S. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1789
n 272×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Dujardin, M. (1979a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIII]. Taxon 28(1, 2/3): 275-276.
CCDB · CromoCat 2015 — Mehra, P. N. (1982). Cytology of East Indian grasses
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Subramanyam, K. & N. P. Kamble. (1967). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XII]. Taxon 16(4): 341-350.
n 81×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bhattacharyya, B. (1973). Chromosome analysis of some Indian members of the tribe Eragrosteae. Journal of Cytology and Genetics 7-8: 161-164
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness97% BUSCO
08Occurrence & distribution
Record type33 371 records
Wild obs. + sensor18 372
Museum / vouchered13 181
Cultivated / captive25
Other1 793
Origin
Native202
Introduced1 436
Range
Area of Occupancy AOO74 564 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy75% within 1 km
≤100 m 6 951≤1 km 2 092≤10 km 2 462>10 km 515
12 020 georeferenced · 6 352 without coordinates
Open the mapobservation + sensor18 372
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 1 073≤1 km 795≤10 km 1 476>10 km 358
3 702 georeferenced · 9 479 without coordinates
Open the institutions mapphysical evidence13 181
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 1
2 georeferenced · 23 without coordinates
Open the mapnot free-living25
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions292 of 620 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 736 |
| MeiseBGlocation not on record | 325 |
| Bronx, US | 311 |
| Durango, MX | 311 |
| Brisbane, AU | 309 |
| Beijing, CN | 304 |
| University of Stellenboschlocation not on record | 292 |
| Wuzhou, CN | 242 |
| Taipei, TW | 217 |
| Kew, GB | 214 |
| Canberra, AU | 196 |
| Odawara, JP | 188 |
| Chongqing Museumlocation not on record | 136 |
| Mount Annan, AU | 133 |
| Sanda, JP | 128 |
| Philadelphia, US | 125 |
| Kunming, CN | 118 |
| Guangzhou, CN | 118 |
| Bloomington, US | 107 |
| Palmerston, AU | 102 |
| Chiba, JP | 97 |
| Université de Bordeauxlocation not on record | 96 |
| KMCClocation not on record | 95 |
| Museo Entomologico de Leonlocation not on record | 95 |
| Auckland, NZ | 94 |
| Chengdu, CN | 92 |
| Tampa, US | 91 |
| UnBlocation not on record | 77 |
| TAIElocation not on record | 75 |
| Kochi, JP | 75 |
| Nanjing, CN | 72 |
| Berlin, DE | 69 |
| Forest Herbarium Ibadan (FHI)location not on record | 69 |
| Austin, US | 67 |
| Nagano City, JP | 65 |
| Adelaide, AU | 65 |
| National Biodiversity Institute, Costa Ricalocation not on record | 62 |
| Ann Arbor, US | 61 |
| Universidade Federal de Pelotaslocation not on record | 60 |
| Xiamen, CN | 59 |
| BIO-UNIPIlocation not on record | 58 |
| SXTCMlocation not on record | 57 |
| Riverside, US | 56 |
| Bangkok, TH | 55 |
| College Park, US | 54 |
| Puerto Ayora, EC | 53 |
| Guilin, CN | 52 |
| Mérida, MX | 51 |
| International Salmonella Centre (W.H.O.)location not on record | 51 |
| Fort Worth, US | 49 |
| Madison, US | 49 |
| Shinshu Universitylocation not on record | 49 |
| Yangling, CN | 49 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 48 |
| Williamsburg, US | 48 |
| Taipei, TW | 47 |
| San Isidro, AR | 47 |
| Moscow State Universitylocation not on record | 47 |
| Chengdu, CN | 47 |
| Seoul, KR | 46 |
| Tsukuba, JP | 45 |
| Tokushima, JP | 45 |
| Pretoria, ZA | 44 |
| Université de Strasbourglocation not on record | 44 |
| Wuhan, CN | 43 |
| Kensington, AU | 42 |
| Toyama, JP | 42 |
| Miami, US | 39 |
| BDBClocation not on record | 39 |
| Adam Mickiewicz University in Poznańlocation not on record | 38 |
| Guangzhou, CN | 38 |
| Jena Microbial Resource Collectionlocation not on record | 37 |
| Paris, FR | 37 |
| Nishihara, JP | 37 |
| Honolulu, US | 36 |
| Torreón, MX | 36 |
| NSMKlocation not on record | 36 |
| València, ES | 36 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 35 |
| BISHlocation not on record | 35 |
| LDlocation not on record | 35 |
| Bando, JP | 34 |
| Ciudad de México, MX | 34 |
| Yaoundé, CM | 33 |
| Universidad Nacional de Colombia (UNAL)location not on record | 32 |
| University of Papua New Guinealocation not on record | 31 |
| New Haven, US | 31 |
| Blumenau, BR | 30 |
| MAlocation not on record | 30 |
| Brussel, BE | 30 |
| UNESP-ISlocation not on record | 30 |
| WAGlocation not on record | 30 |
| Christchurch, NZ | 30 |
| Mexico City, MX | 29 |
| Salvador, BR | 29 |
| Cenargenlocation not on record | 29 |
| Smithfield, AU | 29 |
| Aarhus, DK | 27 |
| Antiguo Cuscatlán, SV | 27 |
| St. Augustine, TT | 27 |
| Tomioka, JP | 27 |
| Córdoba, AR | 25 |
| Hangzhou, CN | 25 |
| Tuscaloosa, US | 25 |
| Mexico City, MX | 25 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 25 |
| Istituto Agrario Castelnuovolocation not on record | 25 |
| Kawasaki Shi Tama Ku, JP | 24 |
| Brasília, BR | 24 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 24 |
| Xinxiang, CN | 24 |
| US | 24 |
| BClocation not on record | 24 |
| Hiratsuka City Museumlocation not on record | 23 |
| UFMSlocation not on record | 23 |
| Barcelona, ES | 23 |
| JBRJlocation not on record | 22 |
| Baroda, IN | 22 |
| LBVlocation not on record | 22 |
| Altos de Pipe, VE | 22 |
| UFERSAlocation not on record | 21 |
| Kagoshima, JP | 21 |
| Herbier National du Gabonlocation not on record | 21 |
| Durham, US | 21 |
| Claremont, US | 21 |
| Universidad de Caldas (UCaldas)location not on record | 21 |
| Valdosta State Universitylocation not on record | 21 |
| Chapingo, MX | 21 |
| Ciudad de México, MX | 20 |
| Guasave, MX | 20 |
| EL PASO, US | 20 |
| Armidale, AU | 20 |
| Jackson, US | 20 |
| Frankfurt am Main | 19 |
| Masindi, UG | 19 |
| Chapel Hill, US | 19 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 19 |
| Brasília, BR | 19 |
| Wellington, NZ | 19 |
| Knoxville, US | 19 |
| ASUlocation not on record | 19 |
| Universidad del Quindío (UniQuindío)location not on record | 18 |
| Davis, US | 18 |
| Zacatecas, MX | 18 |
| DMZ botanic gardenlocation not on record | 18 |
| San Diego, US | 18 |
| Yunnan Universitylocation not on record | 18 |
| Pittsburg, US | 17 |
| Denver, US | 17 |
| California Academy of Scienceslocation not on record | 17 |
| Laboratorio de Ictiologialocation not on record | 17 |
| Plocation not on record | 17 |
| Canadian Department of Agriculturelocation not on record | 16 |
| Burlington, US | 16 |
| Olocation not on record | 16 |
| Allentown, US | 16 |
| Taipei, TW | 16 |
| National Institute of Biological Resourceslocation not on record | 16 |
| Uppsala, SE | 16 |
| Nagatoro-machi, Chichibu-gun, JP | 16 |
| GAlocation not on record | 15 |
| UFBAlocation not on record | 15 |
| Wuhan, CN | 15 |
| Flagstaff, US | 15 |
| Leiden University Medical Centerlocation not on record | 15 |
| Fayetteville, US | 15 |
| CJBGlocation not on record | 15 |
| Juriquilla, MX | 15 |
| Universidade Federal de Sergipe (UFS)location not on record | 15 |
| Rotorua, NZ | 15 |
| Durban, ZA | 14 |
| Fukushima Universitylocation not on record | 14 |
| UNIVASFlocation not on record | 14 |
| Dekalb, US | 14 |
| Feira de Santana, BR | 14 |
| Millersville, US | 14 |
| Granada, ES | 14 |
| GJOlocation not on record | 13 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 13 |
| BAYLUlocation not on record | 13 |
| CASlocation not on record | 13 |
| Loja, EC | 13 |
| Central China Normal Universitylocation not on record | 13 |
| Logan, US | 12 |
| Changsha, CN | 12 |
| EFGlocation not on record | 12 |
| Cape Town, ZA | 12 |
| Culiacán, MX | 12 |
| Montecillo, Texcoco, MX | 12 |
| Zapopan, MX | 12 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 12 |
| UFESlocation not on record | 12 |
| La Paz, MX | 12 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 12 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 12 |
| Santa Cruz de la Sierra, BO | 11 |
| KURAlocation not on record | 11 |
| UFRPElocation not on record | 11 |
| Sagamihara, JP | 11 |
| Departamento de Sistematica e Ecologialocation not on record | 11 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 11 |
| Awka, NG | 11 |
| Morelia, MX | 11 |
| Morgantown, US | 11 |
| Salamanca, ES | 11 |
| Cambridge, US | 11 |
| León, NI | 11 |
| Museu Paraense Emílio Goeldilocation not on record | 11 |
| Xining, CN | 11 |
| Columbia, US | 11 |
| JP | 10 |
| Universidade Federal do Maranhãolocation not on record | 10 |
| Zhengzhou, CN | 10 |
| Wlocation not on record | 10 |
| Cape Town, ZA | 10 |
| Nishihara, JP | 10 |
| J.F.Oberlin Universitylocation not on record | 10 |
| Vitoria, ES | 10 |
| Santa Barbara, US | 10 |
| KR | 9 |
| Nagasaki University - Fisherieslocation not on record | 9 |
| Tapachula, MX | 9 |
| Corrientes, AR | 9 |
| Dresden, DE | 9 |
| Stockholm, SE | 9 |
| Staten Island, US | 9 |
| Hazara Universitylocation not on record | 9 |
| Hobart, AU | 9 |
| Federal University of Espírito Santolocation not on record | 9 |
| LSF/FSA/UAClocation not on record | 9 |
| KIWElocation not on record | 9 |
| Edinburgh, GB | 9 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 9 |
| Glocation not on record | 9 |
| Parthenon Tama History Museumlocation not on record | 9 |
| Chicago, US | 9 |
| TNMlocation not on record | 9 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 8 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 8 |
| Giardini Botanici Hanburylocation not on record | 8 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 8 |
| IPA/SPlocation not on record | 8 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 8 |
| Ischia Marine Centrelocation not on record | 8 |
| San José, CR | 8 |
| Lubbock, US | 8 |
| PUC-RSlocation not on record | 8 |
| BMlocation not on record | 8 |
| South Kensington, GB | 8 |
| Tuxtla Gutiérrez, MX | 8 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 8 |
| Université du Lomélocation not on record | 8 |
| Badajoz, ES | 8 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 8 |
| DanBIFlocation not on record | 8 |
| Bern, CH | 8 |
| Beijing, CN | 8 |
| Zürich, CH | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| Sucre, BO | 7 |
| Dover, US | 7 |
| AUAlocation not on record | 7 |
| University of New Hampshirelocation not on record | 7 |
| Muzaffarabad, PK | 7 |
| Oskarshamn, SE | 7 |
| Mlocation not on record | 7 |
| Autlán de Navarro, MX | 7 |
| TAFORI-LSRClocation not on record | 7 |
| HNBlocation not on record | 7 |
| Tuxtla Gutiérrez, MX | 7 |
| DOI/NPS, Greenbelt Parklocation not on record | 7 |
| Norfolk, US | 7 |
| LaCarto/IGATE/UAClocation not on record | 7 |
| Sendai, JP | 7 |
| Mississippi State, US | 7 |
| Akita Prefectural Museumlocation not on record | 7 |
| Shanghai, CN | 7 |
| Entomological Society of Latvialocation not on record | 7 |
| Emporia, US | 6 |
| UFMGlocation not on record | 6 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 6 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 6 |
| Tall Timbers Research Stationlocation not on record | 6 |
| Austin, US | 6 |
| Castelar, AR | 6 |
| Dehra Dun, IN | 6 |
| Fortaleza, BR | 6 |
| Pamplona, ES | 6 |
| Clocation not on record | 6 |
| Cusco, PE | 6 |
| UFSClocation not on record | 6 |
| Iwate Prefectural Museumlocation not on record | 6 |
| New Brunswick, US | 6 |
| Ishikawa Museum of Natural Historylocation not on record | 6 |
| Texas Lutheran Universitylocation not on record | 6 |
| San Angelo, US | 6 |
| Chadron, US | 6 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 6 |
| University of Tennessee at Chattanoogalocation not on record | 6 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 6 |
| John T. Waterhouse Herbariumlocation not on record | 6 |
| James Cook Townsvillelocation not on record | 6 |
| Jishou Universitylocation not on record | 6 |
| 云南省思茅市民族传统医药研究所location not on record | 6 |
| Universiti Sains Malaysialocation not on record | 6 |
| Paleontological Collectionlocation not on record | 6 |
| Cuiabá, BR | 6 |
| Guatemala City, GT | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 6 |
| UFPElocation not on record | 6 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 5 |
| BRNUlocation not on record | 5 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 5 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 5 |
| Tianjin Natural History Museumlocation not on record | 5 |
| Irvine, US | 5 |
| CICYTEXlocation not on record | 5 |
| Albuquerque, US | 5 |
| Shanghai, CN | 5 |
| FUVATESlocation not on record | 5 |
| The University of Arizonalocation not on record | 5 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 5 |
| San Luis Obispo, US | 5 |
| Ivano-Frankivsk, UA | 5 |
| Museo Achille Folettolocation not on record | 5 |
| CNF-UFHBlocation not on record | 5 |
| QCNElocation not on record | 5 |
| GB | 5 |
| Chaguaramas, TT | 5 |
| EAlocation not on record | 5 |
| Vancouver, CA | 5 |
| Lord Fairfax Community Collegelocation not on record | 5 |
| GZUlocation not on record | 5 |
| McWane Science Centerlocation not on record | 5 |
| Alicante, ES | 5 |
| MEXUlocation not on record | 5 |
| Jataí / Setor Industrial, BR | 5 |
| Mérida, MX | 5 |
| Otaru, JP | 4 |
| Clemson, US | 4 |
| Korea National Arboretumlocation not on record | 4 |
| Instituto de Investigação Científica Tropicallocation not on record | 4 |
| University of Zhejianglocation not on record | 4 |
| Sangmiung Universitylocation not on record | 4 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 4 |
| NO DISPONIBLElocation not on record | 4 |
| Jiangxi College of Educationlocation not on record | 4 |
| Zürich, CH | 4 |
| UNIVILLElocation not on record | 4 |
| Addis Ababa, ET | 4 |
| Little Rock, US | 4 |
| LNBG$location not on record | 4 |
| Davenport, US | 4 |
| Edmonton, CA | 4 |
| Universidad Industrial de Santander (UIS)location not on record | 4 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 4 |
| UTFPR-CPlocation not on record | 4 |
| Santarém, BR | 4 |
| Oiso Municipal Museumlocation not on record | 4 |
| Ciudad Autónoma de Buenos Aires, AR | 4 |
| Osaka, JP | 4 |
| St. Paul, US | 4 |
| Universidad Nacional Federico Villarreallocation not on record | 4 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 4 |
| Pontifícia Universidade Católica do Paranálocation not on record | 4 |
| Madrid, ES | 4 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 4 |
| UNESClocation not on record | 4 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 4 |
| Elocation not on record | 4 |
| Universidade Federale do Rio Grande do Sullocation not on record | 4 |
| Palmerston North, NZ | 3 |
| Museo Athanasius Kircher di Romalocation not on record | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| University of Southern Mississippilocation not on record | 3 |
| UEPAlocation not on record | 3 |
| Fairfax, US | 3 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 3 |
| San Francisco de Campeche, MX | 3 |
| Batemans Bay, AU | 3 |
| Northridge, US | 3 |
| Helsinki, FI | 3 |
| HUT Culture Collectionlocation not on record | 3 |
| BG-NMNHSlocation not on record | 3 |
| Linares, MX | 3 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 3 |
| QAUlocation not on record | 3 |
| Xian, CN | 3 |
| Asheville, US | 3 |
| Criciúma, BR | 3 |
| Johnson City, US | 3 |
| Oswego, US | 3 |
| ENTClocation not on record | 3 |
| Calabar, NG | 3 |
| DNSMlocation not on record | 3 |
| Universidad Nacional Agrarialocation not on record | 3 |
| UFPIlocation not on record | 3 |
| Bogotá, D.C., CO | 3 |
| Obihiro Centennial City Museumlocation not on record | 3 |
| Long Beach, US | 3 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 3 |
| Lincoln, US | 3 |
| IECOSlocation not on record | 3 |
| UNICAMPlocation not on record | 3 |
| UEMlocation not on record | 3 |
| Nijmegen, NL | 3 |
| KOMlocation not on record | 3 |
| Henry Brockhouse Collectionlocation not on record | 3 |
| Universidad Nacional del Litorallocation not on record | 3 |
| La Paz, BO | 3 |
| CEPLAClocation not on record | 3 |
| Hermosillo, MX | 3 |
| PRClocation not on record | 3 |
| UFOPlocation not on record | 3 |
| Mexico City, MX | 3 |
| Pondicherry, IN | 3 |
| Whitehorse, CA | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 2 |
| Macomb, US | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| UTFPR-DVlocation not on record | 2 |
| Yerevan, AM | 2 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 2 |
| Forestry Research Institute of Nigerialocation not on record | 2 |
| RBGlocation not on record | 2 |
| Cochabamba, BO | 2 |
| Denton, US | 2 |
| Henderson State Universitylocation not on record | 2 |
| LISClocation not on record | 2 |
| Philadelphia, US | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| Herbario de la Universidad Tecnológica Indoaméricalocation not on record | 2 |
| UNISANTAlocation not on record | 2 |
| Ixtacuixtla de Mariano Matamoros, MX | 2 |
| INMAlocation not on record | 2 |
| Coimbra, PT | 2 |
| Weber State Universitylocation not on record | 2 |
| Tallinn, EE | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Lima, PE | 2 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 2 |
| SJNAlocation not on record | 2 |
| Gijón, ES | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Grassland Research Institute, Chinese Academy of Agricultural Scienceslocation not on record | 2 |
| Brussels, BE | 2 |
| Montréal, CA | 2 |
| OTSlocation not on record | 2 |
| Provo, US | 2 |
| Botanic Gardenlocation not on record | 2 |
| Hanshan Normal Universitylocation not on record | 2 |
| Peking Universitylocation not on record | 2 |
| Southwest Forestry Collegelocation not on record | 2 |
| Lanzhou, CN | 2 |
| Montpellier, FR | 2 |
| Jiujiang Forestry Institutelocation not on record | 2 |
| Frauenfeld, CH | 2 |
| DSMlocation not on record | 2 |
| Santa Teresa, BR | 2 |
| UNITINSlocation not on record | 2 |
| Lake Charles, US | 2 |
| Boise, US | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| San Jose, US | 2 |
| China Agricultural Universitylocation not on record | 2 |
| Moscow, US | 2 |
| Strecker Museum, Baylor Universitylocation not on record | 2 |
| UERJlocation not on record | 2 |
| Haramaya Universitylocation not on record | 2 |
| LGlocation not on record | 2 |
| Pullman, US | 2 |
| BRLUlocation not on record | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| Campo Mourão, BR | 2 |
| Toronto, CA | 2 |
| Cambridge University Herbariumlocation not on record | 2 |
| QVMAGlocation not on record | 2 |
| South China Normal Universitylocation not on record | 2 |
| Ensenada, MX | 2 |
| FJFClocation not on record | 1 |
| Parkville, AU | 1 |
| CJBNlocation not on record | 1 |
| Victoria, CA | 1 |
| Ojo, NG | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Jinghong, CN | 1 |
| University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record | 1 |
| NHMJlocation not on record | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Phoenix, US | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Puebla, MX | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| Zhejiang Museum of Natural Historylocation not on record | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| FTlocation not on record | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| FJIDClocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Santa Maria, BR | 1 |
| Shenzhen, CN | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Universidad de los Andes (UniAndes)location not on record | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Zlocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Tilburg, NL | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Universität Tübingenlocation not on record | 1 |
| QAPlocation not on record | 1 |
| Botanical Garden "Anastasie Fatu" of Iasilocation not on record | 1 |
| Anhui Normal Universitylocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Managua, NI | 1 |
| HEMlocation not on record | 1 |
| Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| LINUlocation not on record | 1 |
| The CB Rhizobium Collectionlocation not on record | 1 |
| Quito, EC | 1 |
| GENTlocation not on record | 1 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 1 |
| CMULlocation not on record | 1 |
| Limbe Botanical & Zoological Gardenslocation not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| UEMAlocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| UDESC-CAVlocation not on record | 1 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 1 |
| Maringá, BR | 1 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 1 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| DBF-NHMDlocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| FLASlocation not on record | 1 |
| Oulu, FI | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| Université National du Béninlocation not on record | 1 |
| UTPLlocation not on record | 1 |
| Riobamba, EC | 1 |
| München, DE | 1 |
| Goucher Collegelocation not on record | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Cibinong, ID | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| Tulane Universitylocation not on record | 1 |
| Arusha, TZ | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Tartu, EE | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Due West, US | 1 |
| San Francisco, US | 1 |
| Brookings, US | 1 |
| Kingston, US | 1 |
| San Luis Potosí, MX | 1 |
| Salzburg, AT | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Salta, AR | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Bozeman, US | 1 |
| Tempe, US | 1 |
| Kyoto Universitylocation not on record | 1 |
| Görlitz, DE | 1 |
| Conway, US | 1 |
| Collections de la Faculte des Sciences de Lyonlocation not on record | 1 |
| IPHAMETRAlocation not on record | 1 |
| Mount Pleasant, US | 1 |
| UNESP-FCAlocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Spearfish, US | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| Washington, US | 1 |
| UNESP-FCAVlocation not on record | 1 |
| Toluca, MX | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Corvallis, US | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Podgorica, ME | 1 |
| KIRMlocation not on record | 1 |
| Seropédica, BR | 1 |
| Universidade de Passo Fundolocation not on record | 1 |
| Orem, US | 1 |
| Grand Junction, US | 1 |
| New Mexico State Universitylocation not on record | 1 |
| Pelotas, BR | 1 |
| HUENFlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Universidad de Buenos Aireslocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| GMBAlocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Chicago, US | 1 |
| Bourges, FR | 1 |
| Minia, EG | 1 |
| Gump Stationlocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| The Cattle Museumlocation not on record | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| Iquitos, PE | 1 |
620 institutions · 11 841 of 13 181 vouchered records shown · 1 277 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA79 detections
Where the DNA of Eleusine indica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found79
Studies independent surveys2
Countries12
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 79 detections have coordinates
Open the map12 countries0
red soilGrasslandAsphalt Crack Scrub with Malva parviflora, C…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.9 °C 15.4–23.6
Seasonal swing summer↔winter3.90 °C
Max temp (day)26.2 °C 20.1–27.8
Min temp (night)17.8 °C 9.00–19.5
Precipitation238 mm/mo 44.0–245
Air humidity61.1 % 55.7–61.5
Moisture balance87.7 mm/mo -93.3–89.3
Vapour deficit1,015 Pa 804–1,141
Wind speed3.00 m/s 2.40–4.10
Cloud cover52.1 % 25.5–56.0
CHELSA 1981–2010, ~9 km grid, at location & month of 72 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.