Elettaria cardamomum

(L.) Maton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Elettaria

At a glance

Occurrence records275

Data sources15

Biological traits19

DNA specimens9

eDNA detections7

Sources15 archives

Databases and archives Elettaria cardamomum's data was compiled from.

WikipediaWikimedia Foundation20 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility275 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

FooDBThe Metabolomics Innovation Centrecompounds↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionDukesPhytochem · FooDB · LOTUS · NPASS6 040 compounds

Occurrence & distributionGBIF275 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB · GoaT1.4 Gbp

01Narrative

Elettaria cardamomum, commonly known as green or true cardamom, is a herbaceous, perennial plant in the ginger family, native to southern India. It is the most common of the species whose seeds are used as a spice called cardamom. It is cultivated widely in tropical regions and reportedly naturalized in Réunion, Indochina, and Costa Rica.Larsen, K. (1996). A prelimanary checklist of the Zingiberaceae of Thailand. Thai Forest Bulletin (Botany) 24: 35-49.Dy Phon, P. (2000). Dictionnaire des plantes utilisées au Cambodge: 1-915. Chez l'auteur, Phnom Penh, Cambodia.Nelson Sutherland, C.H. (2008). Catálogo de las plantes vasculares de Honduras. Espermatofitas: 1-1576. SERNA/Guaymuras, Tegucigalpa, Honduras.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height3 m

Life cycle & reproduction7

Deciduousnessevergreen

Life formrhizomatous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 400 m

Elevation min1 300 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition6 040 compounds

Compounds documented for Elettaria cardamomum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingHerbs and Spices

Compound class profile5 classes

Aminoacids68

Glycerophospholipids57

Acyclic monoterpenoids56

Menthane monoterpenoids $ Monocyclic monoterpenoids54

Cinnamic acids and derivatives46

Documented compounds6 040 total

Tissue Source Quantified only

Compound	Amount	Source
CARBOHYDRATES	778,000 ppm	DukesPhytochem
ALPHA-TERPINEOL	448,400 ppm	DukesPhytochem
ALPHA-TERPINEOL ACETATE	430,000 ppm	DukesPhytochem
STARCH	400,000 ppm	DukesPhytochem
SABINENE	384,000 ppm	DukesPhytochem
TERPINEOL-ACETATE	382,000 ppm	DukesPhytochem
TERPENYL-ACETATE	377,000 ppm	DukesPhytochem
1,8-CINEOLE	360,000 ppm	DukesPhytochem

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elettaria cardamomum has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL536470.1 ↗352 bpUSA · 2019

ACGT

TGCAGAATCTCGTGAACCATTGAGTCTTTGAACGCAAGTTGTGCCCGAGGCCTTGTGGCCGAGGGCACGCCTGCTTGGGCGTCATGGCAT …

Elettaria cardamomum voucher MO:Carlsen3596 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★ITS5★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Elettaria cardamomum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 403 430 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Elettaria cardamomum1.4 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidy4× tetraploid · measured

Chromosome records48–522n range48median48mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 489×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Sudharshan, M. R. 1987. Colchicine-induced tetraploids in cardamom (Elettaria cardamomum Maton). Curr. Sci. 56: 36–37.

CCDB · book-ipcn67-71 — BISSON, s. ,s. GUILLEMET, & J. - L. HAMEL. 1968. Contribution a l'etude caryo-taxinomique des Scitaminees Mem. Mus. National Hist. Naturelle Ser. B. 18: 59-133.

CCDB · book-ipcn67-71 — RAMACHANDRAN, K. 1969. Chromosome numbers in Zingiberaceae. Cytologia 34: 213-221.

CCDB · book-fedorov — Gregory P. J. 1936

CCDB · book-fedorov — Sharma A. K., Bhattacharyya N. K. 1959c a

CCDB · book-fedorov — SatO D. 1960

CCDB · book-atlas-flowering-plants — Gregory 1936

CCDB · Cave1959 — Sharma & Bhat, 19590

2n 522×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Chakravorti 1948a

CCDB · book-atlas-flowering-plants — Chakravorti 1952

n 242×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BHATTACHARYYA, R. 1968. Systematic status of the family Zingiberaceae. Nucleus, Suppl. vol. 1968: 39-41.

CCDB · book-ipcn67-71 — RAMACHANDRAN, K. 1969. Chromosome numbers in Zingiberaceae. Cytologia 34: 213-221.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type275 records

Wild obs. + sensor149

Museum / vouchered113

Cultivated / captive5

Other8

Origin

Native6

Introduced4

Range

Area of Occupancy AOO564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 22≤1 km 24≤10 km 61>10 km 11

118 georeferenced · 31 without coordinates

Open the mapobservation + sensor149

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 7≤1 km 7≤10 km 6>10 km 4

24 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence113

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 2 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	17
Pondicherry, IN	7
Museo Nacional de Costa Rica (MNCR)location not on record	7
Guatemala, GT	5
Antiguo Cuscatlán, SV	5
Durango, MX	4
Kew, GB	4
Universidad del Quindío (UniQuindío)location not on record	4
Christchurch, NZ	3
Edinburgh, GB	3
University of Stellenboschlocation not on record	3
Berlin, DE	3
Salvador, BR	2
Stockholm, SE	2
Mexico City, MX	2
Baroda, IN	2
Universidad de Caldas (UCaldas)location not on record	2
TAFORI-LSRClocation not on record	2
Xiamen, CN	2
Denver, US	2
Tampa, US	1
Mexico City, MX	1
Altos de Pipe, VE	1
Zürich, CH	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
Seychelles National Herbariumlocation not on record	1
Muzaffarabad, PK	1
Sri Ramaswamy Memorial Universitylocation not on record	1
MeiseBGlocation not on record	1
UFBAlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
UChlocation not on record	1
Uppsala, SE	1
Chapingo, MX	1
National Biodiversity Institute, Costa Ricalocation not on record	1

37 institutions · 98 of 113 vouchered records shown · 15 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Elettaria cardamomum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 15.7–24.6

Seasonal swing summer↔winter16.5 °C

Max temp (day)29.5 °C 21.8–30.3

Min temp (night)16.2 °C 11.5–18.7

Precipitation96.1 mm/mo 20.5–106

Air humidity52.0 % 48.1–55.1

Moisture balance-17.8 mm/mo -78.4–9.60

Vapour deficit1,421 Pa 850–1,577

Wind speed1.80 m/s 1.50–3.10

Cloud cover25.2 % 14.2–38.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Elettaria cardamomum

At a glance

Sources15 archives

Size & morphology1

Life cycle & reproduction7

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

Compound class profile5 classes

Documented compounds6 040 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type275 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 37 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Documented compounds6 040 total