Elephantorrhiza burkei

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Elephantorrhiza

At a glance

Occurrence records128

Data sources9

Biological traits19

DNA specimens8

eDNA detections4

Sources9 archives

Databases and archives Elephantorrhiza burkei's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility128 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources19 traits

Occurrence & distributionGBIF128 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Elephantorrhiza burkei, commonly known as the elephant root or sumach bean, is a deciduous shrub or small tree in the mimosoid clade of legumes. It is native to southern Africa, where it is found on rocky slopes or ridges, in either woodland, grassland or scrubland. The species is named after the botanist Joseph Burke.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology6

Plant height3.5 m

Plant height max10 m

Plant height min0.3 m

Seed mass762 mg

Seed mass max762 mg

Seed mass min762 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberself-supporting

Elevation max1 500 m

Elevation min350 m

Epiphyteterrestrial

Growth formtree

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry2

Leaf n30.4 mg/g

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elephantorrhiza burkei has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes3

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJX572548.1 ↗552 bpSouth Africa · 2009

ACGT

AGTGTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Elephantorrhiza burkii voucher OM1945 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa

plant barcode

08Occurrence & distribution

Record type128 records

Wild obs. + sensor3

Museum / vouchered125

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 123 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	91
Cape Town, ZA	6
Durban, ZA	4
University of Johannesburglocation not on record	3
Cape Town, ZA	3
LNBG$location not on record	2
Zürich, CH	1
South African National Biodiversity Institutelocation not on record	1
MeiseBGlocation not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1
Instituto de Investigação Científica Tropicallocation not on record	1

11 institutions · 114 of 125 vouchered records shown · 11 without an institution code

09Environmental DNA4 detections

Where the DNA of Elephantorrhiza burkei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 20.3–23.8

Seasonal swing summer↔winter9.70 °C

Max temp (day)26.6 °C 25.5–28.8

Min temp (night)16.0 °C 14.5–17.9

Precipitation69.5 mm/mo 36.1–109

Air humidity55.9 % 54.6–57.1

Moisture balance-59.2 mm/mo -97.4–-49.0

Vapour deficit1,141 Pa 1,052–1,320

Wind speed2.50 m/s 2.10–2.70

Cloud cover28.4 % 19.4–40.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)