Elephantopus elatus

Bertol. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Elephantopus

At a glance

Occurrence records1 864

Data sources12

Biological traits7

DNA specimens2

eDNA detections1

Sources12 archives

Databases and archives Elephantopus elatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 864 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF1 864 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Elephantopus elatus, common name tall elephantsfoot, is a North American species of flowering plant in the sunflower family. It is native to the southeastern United States from eastern Louisiana to South Carolina.Biota of North America Program 2014 county distribution map Elephantopus elatus is a perennial herb up to 70 cm (28 inches) tall. Leaves are oblanceolate, up to 20 cm (8 inches) long, darker on the upper side than they are on the lower side. The plant produces numerous small flower heads in a tight cluster, each head generally containing only 4-5 florets.Flora of North America, Elephantopus elatus Bertoloni, Mem. Reale Accad. Sci. Ist. Bologna. 2: 607. 1850.Bertoloni, Antonio 1850. Memorie della Reale Accademia delle Scienze dell' Istituto di Bologna 2: 607 description in LatinBertoloni, Antonio 1850. Memorie della Reale Accademia delle Scienze dell' Istituto di Bologna 2: Plate 45 full-page line drawing of Elephantopus elatus

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition3 compounds

Compounds documented for Elephantopus elatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Germacrane sesquiterpenoids2

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
Elephantin	present	LOTUS
Elephantopin	present	LOTUS
Methane	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elephantopus elatus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences9

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEF155765.1 ↗632 bp

ACGT

TCGATGCAATTCAAAACGAACCGCGAACACGTATTGAAAATCTCGGGCTAGGCGAGACGGCCTTGTGCTCGTCAAGCCCATGCCCCGCCA …

Elephantopus elatus isolate ElephantopueK81 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Elephantopus elatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · book-ipcn67-71 — 71-57

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 864 records

Wild obs. + sensor1 384

Museum / vouchered480

Origin

Native4

Range

Area of Occupancy AOO4 480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 853≤1 km 161≤10 km 51>10 km 62

1 127 georeferenced · 257 without coordinates

Open the mapobservation + sensor1 384

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 14≤1 km 19≤10 km 49>10 km 39

121 georeferenced · 359 without coordinates

Open the institutions mapphysical evidence480

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	138
Jena Microbial Resource Collectionlocation not on record	97
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	40
Miami, US	34
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	22
Valdosta State Universitylocation not on record	15
US	13
Jackson, US	13
Bronx, US	10
Wuzhou, CN	9
Tuscaloosa, US	9
GAlocation not on record	8
Tall Timbers Research Stationlocation not on record	8
Chongqing Museumlocation not on record	6
Mississippi State, US	6
AUAlocation not on record	5
University of Stellenboschlocation not on record	5
University of Southern Mississippilocation not on record	4
Knoxville, US	4
Bangkok, TH	4
University of North Carolina at Pembrokelocation not on record	3
Clemson, US	3
Columbia, US	3
Saint Louis, US	2
Dekalb, US	2
Mérida, MX	2
Tempe, US	2
EL PASO, US	1
Dover, US	1
Stockholm, SE	1
Williamsburg, US	1
Florida Museum of Natural Historylocation not on record	1
Canadian Department of Agriculturelocation not on record	1
McWane Science Centerlocation not on record	1
Little Rock, US	1
College Park, US	1
Chapel Hill, US	1
Phoenix, US	1
BAYLUlocation not on record	1

39 institutions · 479 of 480 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Elephantopus elatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Elephantopus elatus

At a glance

Sources12 archives

Life cycle & reproduction1

Diet & foraging1

Habitat & environment5

Compound class profile1 class

Documented compounds3 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 864 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions24 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 864 records