Eleocharis torticulmis

S.G.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Eleocharis

At a glance

Occurrence records24

Data sources7

Biological traits10

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Eleocharis torticulmis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF24 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Eleocharis torticulmis is a rare species of flowering plant in the sedge family known by the common names twisted spikerush and twist-stem spikerush. It is endemic to Plumas County, California, where it is known from two locations within a kilometer of each other in the Butterfly Valley Botanical Area.Flora of North AmericaThe Nature Conservancy It grows in open wet habitat such as fens and meadows. It was separated from Eleocharis suksdorfiana and described to science as a new species in 2001.Smith, S. G. (2001). Taxonomic innovations in North American Eleocharis (Cyperaceae). Novon 11:2 241-57. This perennial spikerush grows from a tiny rhizome and a small, hard caudex. It produces a tuft of erect stems 20 to 40 centimeters tall. Each stem is spirally twisted and contracted near the tip, becoming somewhat flattened. The spikelet is under a centimeter long and contains up to 10 tiny flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis torticulmis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSFJ826564.1 ↗612 bp

ACGT

TTGCCTTTTGAAAACACGACCCGTGCACATGTAACGTAAAGCTGCCGGGGAGGAGCTCCTCCTCCTCGGCTCCACCGGCCCCGAACATGA …

Eleocharis torticulmis isolate 157 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type24 records

Wild obs. + sensor2

Museum / vouchered22

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	5
Claremont, US	2
University of Stellenboschlocation not on record	2
Flagstaff, US	1
Bronx, US	1
CASlocation not on record	1
EL PASO, US	1
Madison, US	1
Corvallis, US	1
Saint Louis, US	1
Cambridge, US	1

11 institutions · 17 of 22 vouchered records shown · 5 without an institution code

09Environmental DNA1 detections

Where the DNA of Eleocharis torticulmis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)