Eleocharis sundaica

J.Kern · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Eleocharis

At a glance

Occurrence records304

Data sources7

Biological traits19

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Eleocharis sundaica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility304 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources19 traits

Occurrence & distributionGBIF304 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Eleocharis sundaica is a sedge of the family Cyperaceae that is native to Australia. The rhizomatous perennial herb to grass-like sedge typically grows to a height of 0.6 to and is sometime found partly submerged. It blooms between May and August producing white flowers. It is found in and around swamps and pools of water in the Kimberley region of Western Australia where it grows in sandy soils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Fruit length1.75 mm

Fruit width1.4 mm

Plant height1 m

Plant height max1 m

Plant height min0.5 m

Life cycle & reproduction5

Flowering timennnnyyyynnnn

Life formperennial

Life spanannual perennial

⚠ sources differ — AusTraits: annual perennial · GIFT: perennial

Raunkiær life formhemicryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticsemiaquatic

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb (H)

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis sundaica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSFJ826573.1 ↗610 bp

ACGT

TTGCCTTTTGAGAACACGACCGGCGCACGAGTGACTCCGAGCTGCCGGGGAGGCGCTGCCCCCTCGGCCCCGCCGGCCACGAACGCGTGT …

Eleocharis sundaica isolate 217 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type304 records

Wild obs. + sensor83

Museum / vouchered210

Other11

Origin

Native67

Range

Area of Occupancy AOO732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 42

42 georeferenced · 41 without coordinates

Open the mapobservation + sensor83

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 53≤1 km 20≤10 km 86>10 km 3

162 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence210

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	74
Mount Annan, AU	42
Brisbane, AU	29
Canberra, AU	18
Kensington, AU	12
Smithfield, AU	8
Museo Entomologico de Leonlocation not on record	6
John T. Waterhouse Herbariumlocation not on record	5
Armidale, AU	5
Kew, GB	4
Pullman, US	3
Adelaide, AU	1

12 institutions · 207 of 210 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Eleocharis sundaica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)