Eleocharis sphacelata

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Eleocharis

At a glance

Occurrence records5 260

Data sources9

Biological traits48

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Eleocharis sphacelata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 260 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources48 traits

Chemical compositionLOTUS14 compounds

Occurrence & distributionGBIF5 260 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 100

01Narrative

Eleocharis sphacelata, commonly known as tall spikerush, is a sedge of the family Cyperaceae that is native to Australia and New Zealand. The erect rhizomatous perennial herb to grass-like sedge typically grows to a height of 1 to. It blooms between February and October producing white flowers. It is found in and around lagoons and in and swampy areas in coastal parts of the Kimberley, South West, Great Southern and Goldfields-Esperance regions of Western Australia where it grows in black muddy soils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology20

Fruit length2.2 mm

Fruit width2.05 mm

Leaf length max12 mm

Leaf length min4 mm

Leaf size9 425 mm²

Leaf width max12 mm

Leaf width min4 mm

Plant height1.38 m

⚠ sources differ — GIFT: 1.38 m · AusTraits: 2 m

Plant height max5 m

Plant height min0 m

Seed length2.5 mm

Seed length max2.5 mm

Seed length min2.5 mm

Seed mass3.34 mg

⚠ sources differ — TRY: 3.34 mg · AusTraits: 3.76 mg · GIFT: 3.34 mg

Seed mass max4.19 mg

Seed mass min2.52 mg

Seed volume8.2 mm³

Seed volume max8.2 mm³

Seed volume min8.2 mm³

Seed width1 mm

Life cycle & reproduction14

Deciduousnessn.d.

⚠ sources differ — TRY: n.d. · GIFT: evergreen

Dehiscenceindehiscent

Dispersal typewater

Flowering timeyynnnnnnyyyy

Life formperennial

Life spanperennial

Lifespan years100 years

Pollination modeabiotic

Pollination syndromeinsect+wind

⚠ sources differ — AusTraits: insect wind · GIFT: wind

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Reproductive maturity2 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticaquatic

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Habitat GIFTLowland

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition14 compounds

Compounds documented for Eleocharis sphacelata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Noreudesmane sesquiterpenoids3

Anthocyanidins3

Flavones2

Aurones1

Flavonols1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
2-Acetyl-4,8-dihydro-5-methylbenzo[1,2-b:5,4-b']difuran-4,8-dione	present	LOTUS
2-Prop-1-en-2-ylfuro[3,2-f][1]benzofuran-4,8-dione	present	LOTUS
3-[(Z)-heptadec-8-enyl]-2-hydroxy-5-methoxycyclohexa-2,5-diene-1,4-dione	present	LOTUS
5-Methyl-2-prop-1-en-2-yl-2,3,5,6-tetrahydrofuro[3,2-f][1]benzofuran-4,8-dione	present	LOTUS
Aureusidin	present	LOTUS
BENZO(1,2-b:5,4-b')DIFURAN-4,8-DIONE, 2,3-DIHYDRO-2-ISOPROPENYL-5-METHYL-, (-)-	present	LOTUS
Benzo[1,2-b:5,4-b']difuran-4,8-dione, 2-[1-(hydroxymethyl)vinyl]-5-methyl-	present	LOTUS
Cyanidin	present	LOTUS
Cyperaquinone	present	LOTUS
Delphinidin 3-xyloside 7-rhamnosylglucoside	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis sphacelata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFJ826601.1 ↗604 bp

ACGT

TTGCCTCTTGAGAACACGACCGTTGCACAAGTAACCTAAAATCTGCCGAGGAGTTGCTCCCTCGGTTCCATCGGGCCACGAACGTGTTTT …

Eleocharis sphacelata isolate 232 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eleocharis sphacelata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 100 n = 50

Chromosome records100–1002n range100median100mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1002×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — de Lange, P. J., B. G. Murray & P. M. Datson. 2004. Contributions to a chromosome atlas of the New Zealand flora---38. Counts for 50 families. New Zealand J. Bot. 42: 873–904.

08Occurrence & distribution

Record type5 260 records

Wild obs. + sensor4 354

Museum / vouchered854

Other52

Origin

Native289

Introduced1

Range

Area of Occupancy AOO11 480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 870≤1 km 882≤10 km 361>10 km 25

3 138 georeferenced · 1 216 without coordinates

Open the mapobservation + sensor4 354

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 80≤1 km 127≤10 km 279>10 km 54

540 georeferenced · 314 without coordinates

Open the institutions mapphysical evidence854

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	143
Christchurch, NZ	124
Museo Entomologico de Leonlocation not on record	107
Brisbane, AU	76
Canberra, AU	62
Hobart, AU	61
Adelaide, AU	59
Auckland, NZ	54
Wellington, NZ	34
Palmerston, AU	28
QVMAGlocation not on record	13
Armidale, AU	12
Kensington, AU	10
John T. Waterhouse Herbariumlocation not on record	9
Rotorua, NZ	8
Kew, GB	7
Batemans Bay, AU	6
Smithfield, AU	3
James Cook Townsvillelocation not on record	3
Palmerston North, NZ	3
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Pullman, US	2
Chicago, US	1
LDlocation not on record	1
Wollongong, AU	1
Paris, FR	1
Stockholm, SE	1

27 institutions · 831 of 854 vouchered records shown · 23 without an institution code

09Environmental DNA2 detections

Where the DNA of Eleocharis sphacelata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eleocharis sphacelata

At a glance

Sources9 archives

Size & morphology20

Life cycle & reproduction14

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

Compound class profile5 classes

Documented compounds14 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 260 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type5 260 records