Eleocharis palustris
(L.) Roem. & Schult. · speciesAt a glance
Occurrence records259 271
Data sources12
Biological traits128
DNA specimens93
eDNA detections52
Sources12 archives
Databases and archives Eleocharis palustris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility259 271 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics93 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources128 traits
Chemical compositionLOTUS7 compounds
Occurrence & distributionGBIF259 271 records
Environmental DNA1 datasets · 10 countries52 detections
DNA & barcodingBOLD · NCBI93 specimens
Genome at a glanceCCDB · GoaT5.6 Gbp
01Narrative
Le Scirpe des marais dont le nom scientifique est Eleocharis palustris (L.) Roem. & Schult. est l'une des 76 espèces d'Eleocharis, espèce pérenne des zones humides ou marais de la zone circumboréale.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology13
Fruit length max1.5 mm
Fruit length min1.2 mm
Plant height0.463 m
⚠ sources differ — GIFT: 0.463 m · LEDA: 0.525 m · USDA: 0.396 m · TRY: 0.493 m
Plant height generative0.345 m
Plant height max1.2 m
Plant height min0.05 m
Seed length2.16 mm
Seed mass0.915 mg
⚠ sources differ — TRY: 0.915 mg · LEDA: 0.976 mg · GIFT: 0.995 mg
Seed mass max1.45 mg
Seed mass min0.36 mg
Seed volume0.91 mm³
Seed volume max0.91 mm³
Seed volume min0.91 mm³
Life cycle & reproduction36
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessn.d.
⚠ sources differ — TRY: n.d. · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourbrown
Flower conspicuousNo
Flower length max5 mm
Flower length min3 mm
Flowering endAug
Flowering startMay
Fruit seed period beginFall
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: annuals · GIFT: perennial
Lifespan categoryModerate
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formcryptophyte
Resprout abilityNo
Seed number36 834
Seed spread rateModerate
Seedling vigorMedium
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateModerate
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment30
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsNo
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 100 m
Elevation min1 200 m
Epiphyteterrestrial
Foliage colorDark Green
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Growth form USDARhizomatous
Habitat GIFTcanals, meadows
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typenon-mycorrhizal
Root depth min14 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry25
Anaerobic toleranceHigh
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantYes
Fire toleranceMedium
Frost free days min100 days
Leaf c427 mg/g
Leaf dry-matter content (LDMC)238 mg/g
⚠ sources differ — TRY: 238 mg/g · LEDA: 218 mg/g
Leaf n18.89 mg/g
Leaf p1.97 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min16 in
Salinity toleranceLow
Seed longevity index0
Shade toleranceHigh
Soil pH max8 pH
Soil pH min4 pH
Specific leaf area (SLA)10.31 mm²/mg
Temperature min-38 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits9
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max19 000 per acre
Planting density min11 000 per acre
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition7 compounds
Compounds documented for Eleocharis palustris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Noreudesmane sesquiterpenoids3
Aromatic polyketides with side chains1
Documented compounds7 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 2-Acetyl-4,8-dihydro-5-methylbenzo[1,2-b:5,4-b']difuran-4,8-dione | present | LOTUS | |
| 2-Prop-1-en-2-ylfuro[3,2-f][1]benzofuran-4,8-dione | present | LOTUS | |
| 3-[(Z)-heptadec-8-enyl]-2-hydroxy-5-methoxycyclohexa-2,5-diene-1,4-dione | present | LOTUS | |
| 5-Methyl-2-prop-1-en-2-yl-2,3,5,6-tetrahydrofuro[3,2-f][1]benzofuran-4,8-dione | present | LOTUS | |
| BENZO(1,2-b:5,4-b')DIFURAN-4,8-DIONE, 2,3-DIHYDRO-2-ISOPROPENYL-5-METHYL-, (-)- | present | LOTUS | |
| Benzo[1,2-b:5,4-b']difuran-4,8-dione, 2-[1-(hydroxymethyl)vinyl]-5-methyl- | present | LOTUS | |
| Cyperaquinone | present | LOTUS |
05DNA & barcoding93 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis palustris has left across the world's sequence archives.
At a glance
DNA specimens93
Marker genes7
GenBank sequences10
eDNA detections52
Countries10
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCATCCCGAGGGCACGCCTGCCTGGGCGTTAGAAGCCCATCCACGCTCG …
Eleocharis palustris voucher PLT.0070 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL4★rbcLa★trnL-F★ITS2★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Eleocharis palustris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size5 564 820 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Eleocharis palustris5.56 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records8–502n range16median16mode137records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1688×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +14
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · slov-fl — Murín A. & Feráková V., 1981: Karyological study of Slovakian flora III. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 28: 59-62.
CCDB · slov-fl — Bureš P., Rotreklová O., Stoneberg Holt D. S. & Pikner R., 2004a: Cytogeographical survey of Eleocharis subser. Eleocharis in Europe 1: Eleocharis palustris. - Folia Geobotanica 39/3: 235-257.
CCDB · slov-fl — Strandhede S.-O., 1966: Morphologic variation and taxonomy in European Eleocharis, subser. Palustres. - Opera Bot. 10/2: 1-187.
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · brit-fl — Walters, S.M. J. Ecol. 37: 192-206 (1949)
CCDB · brit-fl — Lewis, K.R., John, B. Chromosoma 12: 433-448 (1961)
CCDB · brit-fl — Doxey, D. (1938)
CCDB · fl-europaea — Majovsky et al.,
CCDB · poland — Piech K. 1924. 0 podziale pierwotnego j?dra komrki py?kowej i tworzeniu sie komrek plemnikowych u Scirpus paluslre L. Bull. Intern. Acad. Pol. Sci. et Lett. Sc. Nat. Ser. B, 605-621.
CCDB · poland — Skali?ska M., Pogan E. et al. 1971 a. Further studies in chromosome numbers of Polish Angiosperms. Ninth contribution. Acta Biol. Cracov. Ser. Bot. 14, 199-211.
CCDB · book-ipcn65 — Strandhede 19651c
CCDB · cyper-only — Hicks, G. C.1929
CCDB · cyper-only — Lewitsky, G. A.1940
CCDB · cyper-only — Polya, L.1948
CCDB · cyper-only — Jorgensen, C. A., T. Sorensen & M. Westergaard1958
CCDB · cyper-only — Lve, . & D. Lve1961
CCDB · cyper-only — Lve, . & J. C. Ritchie1966
CCDB · cyper-only — Kuzmanov, B. & S. Kozuharov1969
CCDB · cyper-only — Skalinska, M. & E. Pogan1971
CCDB · cyper-only — Sanyal, B. & A. Sharma1972a
CCDB · cyper-only — Hindakova, M.1974
CCDB · cyper-only — 253Belaeva, V. A. & V. N. Siplivinsky1975
CCDB · cyper-only — Zaborsky, J.1978
CCDB · cyper-only — Lve, . & D. Lve1981
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1978b
CCDB · cyper-only — 254Lewis, K. R. & B. John1961
CCDB · cyper-only — Strandhede, S. O.1961
CCDB · cyper-only — 255Strandhede, S. O.1961
CCDB · cyper-only — Strandhede, S. O.1965c
CCDB · cyper-only — Pogan, E.1972
CCDB · cyper-only — Murin, A. & V. Ferakova1981
CCDB · cyper-only — Skalinska, M., J. Malecka & R. Izmailow1974
CCDB · cyper-only — Bures, P.1998
CCDB · cyper-only — 256Strandhede, S. O.1967
CCDB · cyper-only — 256Lve, . & D. Lve1981
CCDB · ipcn-api-dl — Stoeva, M. P. 1985. Chromosome numbers of Bulgarian angiosperms. Fitologija 30: 78–79.
+44 more references
2n 3831×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +6
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Strandhede S.-O., 1966: Morphologic variation and taxonomy in European Eleocharis, subser. Palustres. - Opera Bot. 10/2: 1-187.
CCDB · brit-fl — Walters, S.M. J. Ecol. 37: 192-206 (1949)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · brit-fl — Walters, S.M. (1950)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Bot. J. Scotl. : ()
CCDB · brit-fl — Lewis, K.R., John, B. Chromosoma 12: 433-448 (1961)
CCDB · brit-fl — Strandhede, O.S. Opera Bot. : 10(2) (1966)
CCDB · fl-europaea — Strandhede, 1965
CCDB · poland — Pogan E. 1972. Studies in Eleocharis R. Br. I. Chromosome numbers of E. palustris (L.) R. et S. and E. uniglumis (Link.) Schult. Acta Biol. Cracov. Ser. Bot. 15, 69-75.
CCDB · cyper-only — Walters, S. M.1949
CCDB · cyper-only — Lve, .1951
CCDB · cyper-only — Walters, S. M.1953
CCDB · cyper-only — Hkansson, A.1954
CCDB · cyper-only — Lve, . & D. Lve1956
CCDB · cyper-only — Lewis, K. R. & B. John1961
CCDB · book-indian_vol2 — Walters, S.M. 1949, 1953 ; Ltsve, A. 1951a ; Hakansson, A. 1954; Ltsve, A. & Love, D. 1956b
CCDB · book-fedorov — Hakansson 1928a
CCDB · CromoCat 2015 — Doxey, D. (1938). The cytology of Eleocharis palustris and related species in Britain. Tesis Manchester
CCDB · CromoCat 2015 — Hakansson, A. (1928). Die chromosomen einiger Scirpoideen. Hereditas 10: 277-292.
CCDB · CromoCat 2015 — Hakansson, A. (1929). Uber verschiedene chromosomenzahlen in Scirpus palustris L. Hereditas 13: 53-60.
CCDB · CromoCat 2015 — Hakansson, A. (1954). Meiosis and pollen mitosis in X-rayed and untreated spikelets of Eleocharis palustris. Hereditas 40: 325-345.
CCDB · CromoCat 2015 — Hakansson, A. (1958). Holocentric chromosomes in Eleocharis. Hereditas 44: 531-540.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1956b). Cytotaxonomical conspectus of the Icelandic flora. Acta Horti Gothob. 20(4): 65-291.
CCDB · CromoCat 2015 — Löve, A. (1951b). Taxonomical evaluation of polyploids. Caryologia 3: 263-284.
CCDB · CromoCat 2015 — Saunte, L. H. (1958). Chromosome variation in the Heleocharis palustris-uniglumis complex. Nature 181: 1019-1020.
CCDB · CromoCat 2015 — Strandhede, S. O. (1958). Eleocharis subseries Palustres i Skandinavien och Finland. Bot. Not. 111: 228-236.
CCDB · CromoCat 2015 — Strandhede, S. O. (1960). A note on Scirpus palustris L. Bot. Not. 113: 161-171.
CCDB · CromoCat 2015 — Walters, S. M. (1949). Eleocharis R. Br. J. Ecol. 37: 192-206.
CCDB · CromoCat 2015 — Walters, S. M. (1950). On the vegetative morphology of Eleocharis R. Br. New Phytol. 49: 1-7.
2n 407×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · poland +2
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Davies, E.W. Hereditas (Lund) 42: 349-365 (1956)
CCDB · brit-fl — Walters, S.M. (1950)
CCDB · poland — Pogan E. 1972. Studies in Eleocharis R. Br. I. Chromosome numbers of E. palustris (L.) R. et S. and E. uniglumis (Link.) Schult. Acta Biol. Cracov. Ser. Bot. 15, 69-75.
CCDB · book-indian_vol2 — Davies, E.W. 1956a
CCDB · CromoCat 2015 — Davies, E. W. (1956a). Cytology, evolution and origin of the aneuploid series in the genus Carex. Hereditas 42: 349-365.
2n 276×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · nw-europe-fl +2
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Lewis, K.R., John, B. Chromosoma 12: 433-448 (1961)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4291
CCDB · book-ipcn65 — Strandhede 1965c
CCDB · cyper-only — Lewis, K. R. & B. John1961
CCDB · cyper-only — Strandhede, S. O.1965b
2n 365×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · cyper-only — 256Strandhede, S. O.1967
CCDB · cyper-only — 256Schuyler, A. E.1977
CCDB · ipcn-api-dl — Schuyler, A. E. 1977. Chromosome observations on some eastern North American Eleocharis (Cyperaceae). Brittonia 29: 129–133.
CCDB · book-ipcn67-71 — STRANDHEDE, S. o. 1967. Eleocharis, subser. Eleocharis in North America. Taxonomical comments and chromosome numbers. Bot. Not. 120: 355-368.
CCDB · book-atlas-flowering-plants — Hicks 1929
2n 154×CCDB · book-indian_vol2 · CCDB · CromoCat 2015
CCDB · book-indian_vol2 — Strandhede, S.O. I965a
CCDB · CromoCat 2015 — Hoshino, T., Rajbhandari, K. R. & Ohba, H. (2000). Cytological studies of eleven species of Cyperaceae collected from central Nepal Cytologia 65: 219-224
CCDB · CromoCat 2015 — Strandhede, S. O. (1965). Chromosome studies in Eleocharis, subser. Palustres. I. Meiosis in some forms with 15 chromosomes. Hereditas 53: 47-62.
CCDB · CromoCat 2015 — Strandhede, S. O. (1966). Morphologic variation and taxonomy in European Eleocharis, subser. Palustres. Opera Bot. 10: 1-187.
2n 373×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Strandhede, O.S. Opera Bot. : 10(2) (1966)
CCDB · brit-fl — Doxey, D. (1938)
2n 502×CCDB · cyper-only · CCDB · book-indian_vol2
CCDB · cyper-only — Tarnavischi, I. T.1948
CCDB · book-indian_vol2 — Tarnavschi, I.T. 1948
2n 81×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — NA
2n 101×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Rohweder, H. (1937). Versuch zur Erfassung der mengenmässigen Bedechung des Darss und Zingst mit polyploiden Pflanzen. Ein Beitrag zur Bedeutung der Polyploidie bei der Eroberung neuer Lebensräume. Planta 27(4): 501-549.
2n 171×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Strandhede, S. O. (1966). Morphologic variation and taxonomy in European Eleocharis, subser. Palustres. Opera Bot. 10: 1-187.
2n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Rohweder, H. (1937). Versuch zur Erfassung der mengenmässigen Bedechung des Darss und Zingst mit polyploiden Pflanzen. Ein Beitrag zur Bedeutung der Polyploidie bei der Eroberung neuer Lebensräume. Planta 27(4): 501-549.
2n 321×CCDB · poland
CCDB · poland — Piech K. 1927. Studia cytologiczne nad rozwojem Scirpus. Rozpr. Wydz. Mat. Przyr. PAU A/B, 93-151.
2n 331×CCDB · book-ipcn65
CCDB · book-ipcn65 — Strandhede 1965c
2n 391×CCDB · poland
CCDB · poland — Pogan E. 1972. Studies in Eleocharis R. Br. I. Chromosome numbers of E. palustris (L.) R. et S. and E. uniglumis (Link.) Schult. Acta Biol. Cracov. Ser. Bot. 15, 69-75.
2n 431×CCDB · brit-fl
CCDB · brit-fl — Strandhede, O.S. Opera Bot. : 10(2) (1966)
n 84×CCDB · cyper-only · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · cyper-only — Thiebaud, M.-A.1970
CCDB · book-ipcn67-71 — THIEBAUD, M.-A. 1970. Contribution a l'etude caryologique Eleocharis R. Br. en Suisse. Candollea 25: 209-219.
CCDB · CromoCat 2015 — Silvestre, S. (1980). Números cromosómicos para la flora española, 150-154. Lagascalia 9(2): 266-269.
CCDB · CromoCat 2015 — Thiebaud, M. A. (1970). Contribution à l'étude caryologique Eleocharis R. Br. en Suisse. Candollea 25: 209-219.
n 73×CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · book-ipcn75-78 — NA
CCDB · CromoCat 2015 — Rath, S. P. (1983). Cytological studies on Indian species of Eleocharis R. Br. (Cyperaceae). Proceedings of the Indian Science Congress Association 70(3-VI): 84.
CCDB · CromoCat 2015 — Strandhede, S. O. (1965). Chromosome studies in Eleocharis, subser. Palustres. I. Meiosis in some forms with 15 chromosomes. Hereditas 53: 47-62.
n 163×CCDB · cyper-only · CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · cyper-only — Majovsky, J., et al.1974b
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · CromoCat 2015 — Rath, S. P. (1983). Cytological studies on Indian species of Eleocharis R. Br. (Cyperaceae). Proceedings of the Indian Science Congress Association 70(3-VI): 84.
n 203×CCDB · cyper-only · CCDB · Cave1956 · CCDB · CromoCat 2015
CCDB · cyper-only — Davies, E. W.1956b
CCDB · Cave1956 — Davies a
CCDB · CromoCat 2015 — Rath, S. P. (1983). Cytological studies on Indian species of Eleocharis R. Br. (Cyperaceae). Proceedings of the Indian Science Congress Association 70(3-VI): 84.
n 192×CCDB · book-ipcn65 · CCDB · cyper-only
CCDB · book-ipcn65 — Strandhede 1965c
CCDB · cyper-only — Strandhede, S. O.1965b
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:889-891
n 51×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Rath, S. P. (1983). Cytological studies on Indian species of Eleocharis R. Br. (Cyperaceae). Proceedings of the Indian Science Congress Association 70(3-VI): 84.
n 91×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Silvestre, S. (1980). Números cromosómicos para la flora española, 150-154. Lagascalia 9(2): 266-269.
n 101×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Rath, S. P. (1983). Cytological studies on Indian species of Eleocharis R. Br. (Cyperaceae). Proceedings of the Indian Science Congress Association 70(3-VI): 84.
n 141×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Rath, S. P. (1983). Cytological studies on Indian species of Eleocharis R. Br. (Cyperaceae). Proceedings of the Indian Science Congress Association 70(3-VI): 84.
n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Rath, S. P. (1983). Cytological studies on Indian species of Eleocharis R. Br. (Cyperaceae). Proceedings of the Indian Science Congress Association 70(3-VI): 84.
n 231×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 25
n 381×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Rath, S. P. (1983). Cytological studies on Indian species of Eleocharis R. Br. (Cyperaceae). Proceedings of the Indian Science Congress Association 70(3-VI): 84.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
08Occurrence & distribution
Record type259 271 records
Wild obs. + sensor239 394
Museum / vouchered18 791
Cultivated / captive32
Fossil4
Other1 050
Origin
Native22 144
Introduced1 295
Range
Area of Occupancy AOO317 140 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy48% within 1 km
≤100 m 53 745≤1 km 37 886≤10 km 96 742>10 km 1 544
189 917 georeferenced · 49 477 without coordinates
Open the mapobservation + sensor239 394
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 1 197≤1 km 3 937≤10 km 6 369>10 km 851
12 354 georeferenced · 6 437 without coordinates
Open the institutions mapphysical evidence18 791
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 15
16 georeferenced · 16 without coordinates
Open the mapnot free-living32
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions196 of 372 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 478 |
| Moscow State Universitylocation not on record | 781 |
| Helsinki, FI | 498 |
| Tartu, EE | 327 |
| Madison, US | 278 |
| LDlocation not on record | 276 |
| St. Paul, US | 272 |
| Victoria, CA | 261 |
| Flagstaff, US | 251 |
| Montréal, CA | 235 |
| MeiseBGlocation not on record | 234 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 212 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 192 |
| Irkutsk State Universitylocation not on record | 190 |
| Badajoz, ES | 187 |
| Chongqing Museumlocation not on record | 187 |
| Oulu, FI | 186 |
| Acadia Universitylocation not on record | 173 |
| Albuquerque, US | 160 |
| Claremont, US | 152 |
| Salzburg, AT | 150 |
| Toronto, CA | 146 |
| WTUlocation not on record | 140 |
| Québec, CA | 130 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 129 |
| Bronx, US | 128 |
| Moscow, US | 127 |
| Ann Arbor, US | 126 |
| Missoula, US | 124 |
| Wuzhou, CN | 123 |
| Uppsala, SE | 123 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 115 |
| KMNlocation not on record | 112 |
| Oskarshamn, SE | 111 |
| University of New Hampshirelocation not on record | 110 |
| Garðabær, IS | 105 |
| Adam Mickiewicz University in Poznańlocation not on record | 102 |
| Green Bay, US | 101 |
| Denver, US | 99 |
| Corvallis, US | 98 |
| ASUlocation not on record | 97 |
| Entomological Society of Latvialocation not on record | 93 |
| València, ES | 91 |
| BFLlocation not on record | 87 |
| University of Alberta Museumslocation not on record | 86 |
| CJBGlocation not on record | 86 |
| Logan, US | 85 |
| Vancouver, CA | 83 |
| SLU Artdatabankenlocation not on record | 82 |
| Vitoria, ES | 81 |
| DOI/NPS, Greenbelt Parklocation not on record | 78 |
| Metsähallituslocation not on record | 76 |
| Jyväskylä, FI | 72 |
| BRNUlocation not on record | 72 |
| Uniwersytet Warszawskilocation not on record | 69 |
| Pullman, US | 68 |
| Görlitz, DE | 67 |
| Austin, US | 67 |
| Saint Louis, US | 64 |
| Turku, FI | 64 |
| Wlocation not on record | 62 |
| Bloomington, US | 62 |
| South Kensington, GB | 61 |
| CICYTEXlocation not on record | 59 |
| Bozeman, US | 58 |
| Caldwell, US | 57 |
| MAlocation not on record | 57 |
| Bern, CH | 52 |
| Provo, US | 51 |
| Phoenix, US | 47 |
| Fort Worth, US | 47 |
| Université Lavallocation not on record | 46 |
| Barcelona, ES | 44 |
| TUR-Alocation not on record | 43 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 41 |
| BClocation not on record | 40 |
| New Haven, US | 39 |
| Berlin, DE | 39 |
| Kuopio, FI | 39 |
| Philadelphia, US | 38 |
| WINlocation not on record | 38 |
| BDBClocation not on record | 37 |
| Boise, US | 35 |
| DBF-NHMDlocation not on record | 35 |
| Pittsburg, US | 35 |
| Nagano City, JP | 35 |
| Lincoln, US | 34 |
| Durham, US | 33 |
| Angwin, US | 33 |
| 32 | |
| Philadelphia, US | 32 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 31 |
| Pocatello, US | 30 |
| Saint John, CA | 29 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 29 |
| University of Stellenboschlocation not on record | 28 |
| Chadron, US | 28 |
| San Angelo, US | 28 |
| Provincia di Livornolocation not on record | 27 |
| Salamanca, ES | 27 |
| Riverside, US | 26 |
| Olocation not on record | 25 |
| Portland, US | 25 |
| GJOlocation not on record | 24 |
| Durango, US | 23 |
| Dresden, DE | 21 |
| San Sebastián, ES | 21 |
| EL PASO, US | 21 |
| Chapel Hill, US | 20 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 19 |
| BAYLUlocation not on record | 19 |
| Museo Achille Folettolocation not on record | 19 |
| JP | 19 |
| Nijmegen, NL | 19 |
| SIHUlocation not on record | 18 |
| Christchurch, NZ | 18 |
| US | 18 |
| Jackson, US | 17 |
| Natural History Museum Rotterdamlocation not on record | 17 |
| Bangkok, TH | 17 |
| Burlington, US | 17 |
| Texas Lutheran Universitylocation not on record | 17 |
| GB | 16 |
| Bend, US | 16 |
| Tampa, US | 16 |
| Córdoba, ES | 15 |
| Grand Junction, US | 15 |
| UGentlocation not on record | 15 |
| Dekalb, US | 15 |
| Santa Barbara, US | 15 |
| International Salmonella Centre (W.H.O.)location not on record | 15 |
| Fulda, DE | 14 |
| Pamplona, ES | 14 |
| San Diego, US | 14 |
| Madrid, ES | 14 |
| Paris, FR | 13 |
| DULlocation not on record | 13 |
| Phyletisches Museum Jenalocation not on record | 13 |
| Davis, US | 13 |
| Philadelphia, US | 13 |
| Yukon Universitylocation not on record | 13 |
| Anchorage, US | 13 |
| Alicante, ES | 12 |
| SZUlocation not on record | 12 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 12 |
| Auckland, NZ | 12 |
| PrivatHerblocation not on record | 12 |
| College of the Atlantic, Museumlocation not on record | 12 |
| PRClocation not on record | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 11 |
| Mlocation not on record | 11 |
| Tallinn, EE | 11 |
| Mount Pleasant, US | 11 |
| Bandelier National Monumentlocation not on record | 11 |
| Beijing, CN | 11 |
| Whitewater, US | 11 |
| Oswego, US | 11 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 11 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 11 |
| Spearfish, US | 11 |
| Frankfurt am Main | 11 |
| College Park, US | 11 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 10 |
| Orem, US | 10 |
| Tacoma, US | 10 |
| Allentown, US | 10 |
| Tula State Universitylocation not on record | 9 |
| Sevilla, ES | 9 |
| Weber State Universitylocation not on record | 9 |
| Karlsruhe, DE | 9 |
| Frauenfeld, CH | 9 |
| Wellington, NZ | 9 |
| Institute of the biological problems of the North FEB RASlocation not on record | 9 |
| GMBAlocation not on record | 8 |
| Henderson, US | 8 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 8 |
| Montréal, CA | 8 |
| Forssa, FI | 8 |
| Porrentruy, CH | 8 |
| Morgantown, US | 8 |
| OLAlocation not on record | 8 |
| ZRC-SAZUlocation not on record | 8 |
| McWane Science Centerlocation not on record | 8 |
| Tuscaloosa, US | 7 |
| Glarus, CH | 7 |
| Bergen, NO | 7 |
| Cheney, US | 7 |
| Stephenville, US | 7 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 7 |
| Davenport, US | 6 |
| Pamplona, ES | 6 |
| Rocky Mountain Biological Laboratorylocation not on record | 6 |
| Wuhan, CN | 6 |
| Granada, ES | 6 |
| Springfield, US | 6 |
| Peking Universitylocation not on record | 6 |
| BSBIlocation not on record | 6 |
| University of Wisconsinlocation not on record | 6 |
| Tromso University Museumlocation not on record | 6 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 5 |
| Tianjin Natural History Museumlocation not on record | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| University of Winnipeglocation not on record | 5 |
| Tilburg, NL | 5 |
| Edinburgh, GB | 5 |
| Brussel, BE | 5 |
| BG-NMNHSlocation not on record | 5 |
| University of Lethbridgelocation not on record | 5 |
| Universidad de Caldas (UCaldas)location not on record | 5 |
| US | 5 |
| Kew, GB | 5 |
| University of Wisconsinlocation not on record | 5 |
| Trondheim, NO | 5 |
| LfUlocation not on record | 5 |
| Ypsilanti, US | 5 |
| Williamsburg, US | 5 |
| Eastern Nevada Landscape Coalitionlocation not on record | 5 |
| Whitehorse, CA | 5 |
| CASlocation not on record | 4 |
| Staten Island, US | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Bothell, US | 4 |
| Université de Bordeauxlocation not on record | 4 |
| USFS/BHSClocation not on record | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Honolulu, US | 4 |
| B.A. Bennett Herbariumlocation not on record | 4 |
| Denton, US | 4 |
| Arcata, US | 4 |
| Emporia, US | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Xiamen, CN | 3 |
| Hunan Geological Museumlocation not on record | 3 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Chicago, US | 3 |
| Fairfax, US | 3 |
| Mississippi State, US | 3 |
| Salvador, BR | 3 |
| Long Beach, US | 3 |
| IWEP FEB RASlocation not on record | 3 |
| Winterthur, CH | 3 |
| US | 3 |
| Irvine, US | 3 |
| UIBlocation not on record | 3 |
| JBSlocation not on record | 3 |
| LINUlocation not on record | 3 |
| Maryland Department of Natural Resourceslocation not on record | 3 |
| Ashland, US | 3 |
| Royal Alberta Museumlocation not on record | 3 |
| University of Manitoba Herbariumlocation not on record | 3 |
| Portland, US | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Royal Botanic Garden Edinburghlocation not on record | 3 |
| nbflocation not on record | 3 |
| BIO-UNIPIlocation not on record | 3 |
| AUAlocation not on record | 3 |
| Rovaniemi, FI | 3 |
| Portland, US | 3 |
| US | 3 |
| Universität Erlangen-Nürnberglocation not on record | 2 |
| Millersville, US | 2 |
| Columbia, US | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Yellowstone National Park Herbariumlocation not on record | 2 |
| Washington, US | 2 |
| Fukushima Universitylocation not on record | 2 |
| Little Rock, US | 2 |
| SEFlocation not on record | 2 |
| Kandalaksha State Nature Reservelocation not on record | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| No collectionlocation not on record | 2 |
| STNFlocation not on record | 2 |
| Knoxville, US | 2 |
| Jena Microbial Resource Collectionlocation not on record | 2 |
| Porto Alegre, BR | 2 |
| Guangzhou, CN | 2 |
| Servico de Microbiologia e Imunologialocation not on record | 2 |
| Guasave, MX | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| San Luis Obispo, US | 2 |
| Kushiro City Museumlocation not on record | 2 |
| BGBMlocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Bourges, FR | 2 |
| Shanghai, CN | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| National Botanic Garden of Waleslocation not on record | 2 |
| Namur, BE | 2 |
| Zürich, CH | 2 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 2 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| INFlocation not on record | 2 |
| South China Normal Universitylocation not on record | 1 |
| GAlocation not on record | 1 |
| Fargo, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Canadian Museum of Naturelocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| FLADlocation not on record | 1 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 |
| USFSlocation not on record | 1 |
| Churchill Northern Studies Centrelocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 1 |
| Lausanne, CH | 1 |
| UnBlocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Gijón, ES | 1 |
| Walla Walla, US | 1 |
| Nanjing, CN | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Mexico City, MX | 1 |
| Rishon Le Zion, IL | 1 |
| THIMlocation not on record | 1 |
| Forest Herbarium Ibadan (FHI)location not on record | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| EFGlocation not on record | 1 |
| Monastir, TN | 1 |
| GZUlocation not on record | 1 |
| Ensenada, MX | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| Elikins, US | 1 |
| Tempe, US | 1 |
| Hazara Universitylocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Fayetteville, US | 1 |
| Taipei, TW | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Banyoles, ES | 1 |
| EEZA-CSIClocation not on record | 1 |
| Zürich, CH | 1 |
| Yangling, CN | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| BMlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Durango, MX | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| Fredericksburg, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| UMKClocation not on record | 1 |
| San Francisco, US | 1 |
| Hokkaido University Museumlocation not on record | 1 |
| Shanghai, CN | 1 |
| Dover, US | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| GINRlocation not on record | 1 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 1 |
| NoColllocation not on record | 1 |
| Lubbock, US | 1 |
| La Paz, MX | 1 |
| Los Angeles, US | 1 |
| Johnson City, US | 1 |
| Juriquilla, MX | 1 |
| Pomona Collegelocation not on record | 1 |
| Austin, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Stockholm, SE | 1 |
| Kunming, CN | 1 |
| ULBF-AGRlocation not on record | 1 |
| Kingston, US | 1 |
372 institutions · 17 732 of 18 791 vouchered records shown · 881 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA52 detections
Where the DNA of Eleocharis palustris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found52
Studies independent surveys1
Countries10
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 52 detections have coordinates
Open the map10 countries0
on pond edgeWet Meadow surrounded by Oak Woodland with M…Open soft, fine, alluvium of bare areas with…Low sedge meadow adjacent to old beach ridge…Recovering goose Damage on peat mud flat dep…Fragments and damaged plants washed up on gr…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.6 °C 10.1–16.8
Seasonal swing summer↔winter20.8 °C
Max temp (day)17.6 °C 13.9–21.2
Min temp (night)10.4 °C 6.50–14.2
Precipitation76.8 mm/mo 55.6–104
Air humidity62.0 % 55.4–64.3
Moisture balance-21.4 mm/mo -70.4–71.4
Vapour deficit670 Pa 435–817
Wind speed3.30 m/s 2.30–8.20
Cloud cover44.5 % 35.2–63.1
CHELSA 1981–2010, ~9 km grid, at location & month of 43 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.