Eleocharis pallens

S.T.Blake · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Eleocharis

At a glance

Occurrence records2 770

Data sources9

Biological traits35

DNA specimens2

eDNA detections3

Sources9 archives

Databases and archives Eleocharis pallens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 770 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF2 770 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Eleocharis pallens, commonly known as pale spikerush, is a sedge of the family Cyperaceae that is native to Australia. The perennial herb to grass-like sedge typically grows to a height of 0.5 m and has a tufted habit. It blooms between July and August and produces green flowers. It is found in and around swampy areas and pools in the Pilbara, Gascoyne and Goldfields-Esperance regions of Western Australia and the top end of the Northern Territory.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length1.25 mm

Fruit width0.95 mm

Leaf length max1 mm

Leaf length min0.5 mm

Leaf width max1 mm

Leaf width min0.5 mm

Plant height0.5 m

Plant height max0.5 m

Seed mass0.32 mg

⚠ sources differ — TRY: 0.32 mg · AusTraits: 0.383 mg · GIFT: 0.32 mg

Seed mass max0.32 mg

Seed mass min0.32 mg

Seed volume0.9 mm³

Seed volume max0.9 mm³

Seed volume min0.9 mm³

Life cycle & reproduction9

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life formperennial

Life spanperennial

Pollination syndromeinsect+wind

Raunkiær life formhemicryptophyte

Resprouting capacitypartial_resprouting resprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition7 compounds

Compounds documented for Eleocharis pallens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Anthocyanidins3

Flavonols2

Aurones1

Flavones1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
Aureusidin	present	LOTUS
Cyanidin	present	LOTUS
Kaempferol	present	LOTUS
Pelargonidin	present	LOTUS
Quercetin	present	LOTUS
Tricin	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis pallens has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSGU110858.1 ↗608 bp

ACGT

TTGTTGCCTTTTGAAAACACGACCGGTGCACGAGTAAATAAACTCCGTCGGCGAGGGCAACCTCCTCGGCTCCACCGACCCCGAACAGCT …

Eleocharis pallens voucher F. J. Badman 3775 (WS) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eleocharis pallens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Chromosome records40–402n range40median40mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×CCDB · cyper-only · CCDB · book-ipcn67-71

CCDB · cyper-only — Briggs, B. G.1970

CCDB · book-ipcn67-71 — BRIGGS, B.G. 1970. Chromosome numbers in some Australian species of Eleocharis (Cyperaceae). Contr. New South Wales Natl. Herb. 4: 130-136.

08Occurrence & distribution

Record type2 770 records

Wild obs. + sensor1 631

Museum / vouchered1 060

Cultivated / captive2

Other77

Origin

Native335

Range

Area of Occupancy AOO6 388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1 435≤1 km 132≤10 km 19>10 km 3

1 589 georeferenced · 42 without coordinates

Open the mapobservation + sensor1 631

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 245≤1 km 168≤10 km 428>10 km 84

925 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence1 060

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	257
Brisbane, AU	190
Adelaide, AU	152
Canberra, AU	119
Palmerston, AU	90
Museo Entomologico de Leonlocation not on record	67
Armidale, AU	49
Kensington, AU	30
NSW Dept of Planning, Industry and Environmentlocation not on record	21
Hobart, AU	9
NSW Office of Environment and Heritagelocation not on record	7
John T. Waterhouse Herbariumlocation not on record	6
Pullman, US	6
Christchurch, NZ	5
Auckland, NZ	4
MAlocation not on record	3
Buenos Aires, AR	2
IPA/SPlocation not on record	2
Smithfield, AU	2
Honolulu, US	2
Guangzhou, CN	2
MeiseBGlocation not on record	1
GZUlocation not on record	1
GB	1
UnBlocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Stockholm, SE	1
EL PASO, US	1

28 institutions · 1 032 of 1 060 vouchered records shown · 28 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Eleocharis pallens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eleocharis pallens

At a glance

Sources9 archives

Size & morphology14

Life cycle & reproduction9

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

Other traits1

Compound class profile4 classes

Documented compounds7 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 770 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 28 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 770 records