Eleocharis pachycarpa

É.Desv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Eleocharis

At a glance

Occurrence records183

Data sources9

Biological traits22

DNA specimens2

eDNA detections4

Sources9 archives

Databases and archives Eleocharis pachycarpa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility183 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF183 records

Environmental DNA2 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Eleocharis pachycarpa là loài thực vật có hoa trong họ Cói. Loài này được É.Desv. mô tả khoa học đầu tiên năm 1854.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology4

Fruit length1.1 mm

Fruit width0.9 mm

Leaf length max0.5 mm

Leaf width max0.5 mm

Life cycle & reproduction6

Dehiscenceindehiscent

Flowering timeyynnnnnnyyyy

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 400 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayunknown

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis pachycarpa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU110856.1 ↗609 bp

ACGT

TTGTTGCCTTTTTGAAAACACGACCGGCGCACGAGTAAAGAAACGCTGCCGGGGAGGGCAACCTCCTCGGCTCCACCGGCCCCGAGCAGC …

Eleocharis pachycarpa voucher L. Ahart 5161 (WTU) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eleocharis pachycarpa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Chromosome records40–402n range40median40mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×CCDB · cyper-only · CCDB · book-ipcn67-71

CCDB · cyper-only — Briggs, B. G.1970

CCDB · book-ipcn67-71 — BRIGGS, B.G. 1970. Chromosome numbers in some Australian species of Eleocharis (Cyperaceae). Contr. New South Wales Natl. Herb. 4: 130-136.

08Occurrence & distribution

Record type183 records

Wild obs. + sensor4

Museum / vouchered179

Origin

Introduced9

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 9≤1 km 44≤10 km 44>10 km 3

100 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence179

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	34
Davis, US	13
Arcata, US	9
Mount Annan, AU	8
Canadian Department of Agriculturelocation not on record	8
UChlocation not on record	7
EL PASO, US	5
San Diego, US	5
Claremont, US	5
San Angelo, US	4
Brisbane, AU	4
Riverside, US	3
Santa Barbara, US	3
John T. Waterhouse Herbariumlocation not on record	3
Christchurch, NZ	3
Boise, US	2
Flagstaff, US	2
Buenos Aires, AR	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
MAlocation not on record	2
Corvallis, US	2
University of Stellenboschlocation not on record	2
San Isidro, AR	2
San Luis Obispo, US	2
San Jose, US	1
Armidale, AU	1
Museo Entomologico de Leonlocation not on record	1
Herbario Universidad de Concepciónlocation not on record	1
Wellington, NZ	1
WTUlocation not on record	1
Adelaide, AU	1
La Paz, MX	1
Canberra, AU	1

33 institutions · 141 of 179 vouchered records shown · 38 without an institution code

09Environmental DNA4 detections

Where the DNA of Eleocharis pachycarpa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 21.1–21.1

Seasonal swing summer↔winter12.3 °C

Max temp (day)25.9 °C

Min temp (night)16.2 °C

Precipitation166 mm/mo

Air humidity58.9 %

Moisture balance22.7 mm/mo

Vapour deficit1,019 Pa

Wind speed3.50 m/s

Cloud cover37.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)