Eleocharis ovata
(Roth) Roem. & Schult. · speciesAt a glance
Occurrence records14 713
Data sources10
Biological traits108
DNA specimens15
eDNA detections9
Sources10 archives
Databases and archives Eleocharis ovata's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility14 713 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics15 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources108 traits
Occurrence & distributionGBIF14 713 records
Environmental DNA1 datasets · 2 countries9 detections
DNA & barcodingBOLD · NCBI15 specimens
Genome at a glanceCCDB · GoaT685 Mbp
01Narrative
Eleocharis ovata, the ovate spikerush, is a species of annual grass in the family Cyperaceae (sedges). They have a self-supporting growth form and have simple, broad leaves and green flowers. Individuals can grow to 1.5 feet.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology8
Plant height0.318 m
⚠ sources differ — GIFT: 0.318 m · LEDA: 0.175 m · USDA: 0.457 m · TRY: 0.276 m
Plant height generative0.175 m
Plant height max0.4 m
Plant height min0.01 m
Seed length1.04 mm
Seed mass0.11 mg
⚠ sources differ — TRY: 0.11 mg · LEDA: 0.132 mg · GIFT: 0.115 mg
Seed mass max0.11 mg
Seed mass min0.11 mg
Life cycle & reproduction33
Bloom periodLate Summer
Coppice potentialNo
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typewater
Flower colourgreen
Flower conspicuousNo
Flowering endAug
Flowering startJun
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment26
Active growth periodSummer and Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max1 580 m
Elevation min1 580 m
Epiphyteterrestrial
Foliage porosity summerPorous
Foliage porosity winterPorous
Fruit colourbrown
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Graminoid
Growth form USDABunch
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza type0.0000364
Root depth min6 in
Shape and orientationSemi-Erect
Small grainNo
Woodinessnon-woody
Physiology & chemistry20
Anaerobic toleranceHigh
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceNone
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min90 days
Leaf dry-matter content (LDMC)170 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min32 in
Salinity toleranceLow
Shade toleranceHigh
Soil pH max6.8 pH
Soil pH min4.6 pH
Temperature min47 °F
Uses & economy12
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits7
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max4 800 per acre
Planting density min2 700 per acre
05DNA & barcoding15 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis ovata has left across the world's sequence archives.
At a glance
DNA specimens15
Marker genes5
GenBank sequences10
eDNA detections9
Countries4
The DNA barcodea real sequence read deposited for this species
AACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCATCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTCG …
Eleocharis ovata voucher 68167HIM 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL6★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Eleocharis ovata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size684 600 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Eleocharis ovata0.68 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 10 n = 5
Chromosome records10–102n range10median10mode9records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 109×GoaT · Kew Plant DNA C-values Database · CCDB · cyper-only · CCDB · ipcn-api-dl +4
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · cyper-only — Sanyal, B. & A. Sharma1972a
CCDB · cyper-only — Hines, D. M.1973
CCDB · ipcn-api-dl — Yano, O., T. Katsuyama, H. Tsubota & T. Hoshino. 2004. Molecular phylogeny of Japanese Eleocharis (Cyperaceae) based on ITS sequence data and chromosomal evolution. J. Pl. Res. 117: 409–419.
CCDB · ipcn-api-dl — Rotreklova. 2004. Chromosome numbers for some species of vascular plants from Europe. Biologia (Bratislava) 59: 425–433.
CCDB · book-ipcn72 — SANYAL, B., & A. SHARMA. 1972. Cytological studies in Indian Cyperaceae. I. Tribe Scirpeae. Cytologia 37: 13-32.
CCDB · book-indian_vol2 — Sanyal, B. & Sharma, A. 1972 ; Hines, D.M. 1973
CCDB · eflora
CCDB · kew — Zedek F, Smerda J, Smarda P, Bures P. 2010. Correlated evolution of LTR retrotransposons and genome size in the genus Eleocharis. BMC Plant Biology 10: 265.
08Occurrence & distribution
Record type14 713 records
Wild obs. + sensor12 357
Museum / vouchered2 351
Fossil1
Other4
Origin
Native2
Range
Area of Occupancy AOO20 200 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy13% within 1 km
≤100 m 614≤1 km 756≤10 km 8 772>10 km 187
10 329 georeferenced · 2 028 without coordinates
Open the mapobservation + sensor12 357
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 132≤1 km 347≤10 km 566>10 km 33
1 078 georeferenced · 1 273 without coordinates
Open the institutions mapphysical evidence2 351
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions93 of 173 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BRNUlocation not on record | 190 |
| St. Paul, US | 183 |
| Uniwersytet Wrocławskilocation not on record | 174 |
| Moscow State Universitylocation not on record | 159 |
| Saint Louis, US | 144 |
| BFLlocation not on record | 111 |
| MeiseBGlocation not on record | 81 |
| Madison, US | 78 |
| Brussel, BE | 64 |
| Tuscaloosa, US | 59 |
| Québec, CA | 39 |
| Burlington, US | 37 |
| Bronx, US | 37 |
| WTUlocation not on record | 31 |
| GB | 31 |
| SIHUlocation not on record | 28 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 26 |
| College Park, US | 26 |
| CJBGlocation not on record | 24 |
| GJOlocation not on record | 23 |
| Ann Arbor, US | 23 |
| Moscow, US | 23 |
| Shinshu Universitylocation not on record | 23 |
| Pullman, US | 21 |
| Montréal, CA | 20 |
| Toronto, CA | 20 |
| Chongqing Museumlocation not on record | 19 |
| Portland, US | 18 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 18 |
| Chengdu, CN | 16 |
| Vancouver, CA | 14 |
| New Haven, US | 13 |
| Dresden, DE | 13 |
| Berlin, DE | 13 |
| BIO-UNIPIlocation not on record | 13 |
| Missoula, US | 12 |
| Salzburg, AT | 12 |
| Odawara, JP | 12 |
| Wuzhou, CN | 12 |
| Provincia di Livornolocation not on record | 11 |
| Bern, CH | 11 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 11 |
| Flagstaff, US | 10 |
| Corvallis, US | 10 |
| Victoria, CA | 10 |
| DULlocation not on record | 10 |
| Porrentruy, CH | 10 |
| Kirksville, US | 9 |
| LDlocation not on record | 9 |
| Auckland, NZ | 9 |
| Green Bay, US | 9 |
| Saint John, CA | 9 |
| Adam Mickiewicz University in Poznańlocation not on record | 8 |
| Bloomington, US | 8 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 7 |
| LfUlocation not on record | 6 |
| KIRMlocation not on record | 6 |
| Christchurch, NZ | 6 |
| Dekalb, US | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| Kushiro City Museumlocation not on record | 6 |
| Tampa, US | 6 |
| University of Wisconsinlocation not on record | 6 |
| PRClocation not on record | 6 |
| Université Lavallocation not on record | 5 |
| Conway, US | 5 |
| Richmond, US | 5 |
| Oskarshamn, SE | 5 |
| Mlocation not on record | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| University of Alberta Museumslocation not on record | 5 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 5 |
| Philadelphia, US | 5 |
| Montréal, CA | 5 |
| GZUlocation not on record | 4 |
| Bozeman, US | 4 |
| Jackson, US | 4 |
| Paris, FR | 4 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 4 |
| Nagano City, JP | 4 |
| Chicago, US | 4 |
| Wlocation not on record | 4 |
| Acadia Universitylocation not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Beijing, CN | 3 |
| LINUlocation not on record | 3 |
| Phoenix, US | 3 |
| Springfield, US | 3 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| Durham, US | 3 |
| Zürich, CH | 3 |
| UGentlocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Hokkaido University Botanic Gardenlocation not on record | 3 |
| Tartu, EE | 2 |
| Bangkok, TH | 2 |
| University of Stellenboschlocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| No collectionlocation not on record | 2 |
| Whitehorse, CA | 2 |
| ASUlocation not on record | 2 |
| Bend, US | 2 |
| Bourges, FR | 2 |
| Sendai, JP | 2 |
| New Brunswick, US | 2 |
| Fukushima Universitylocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| ifplocation not on record | 2 |
| Tsukuba, JP | 2 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 2 |
| International Salmonella Centre (W.H.O.)location not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| H-Adlerlocation not on record | 2 |
| Sion, CH | 2 |
| Davenport, US | 2 |
| McGill University, Herbariumlocation not on record | 2 |
| Columbia, US | 2 |
| Wellington, NZ | 2 |
| Keene State Universitylocation not on record | 2 |
| Obihiro Centennial City Museumlocation not on record | 2 |
| MILlocation not on record | 2 |
| Henderson, US | 1 |
| Porto Alegre, BR | 1 |
| Logan, US | 1 |
| Mohonk Preservelocation not on record | 1 |
| Staten Island, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Toyama, JP | 1 |
| UMKClocation not on record | 1 |
| Mexico City, MX | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Sapporo, JP | 1 |
| Mississippi State, US | 1 |
| University of Lethbridgelocation not on record | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| San Angelo, US | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| Chapel Hill, US | 1 |
| Macomb, US | 1 |
| Henderson State Universitylocation not on record | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Caldwell, US | 1 |
| Universität Göttingenlocation not on record | 1 |
| Wuhan, CN | 1 |
| Ashland, US | 1 |
| Russellville, US | 1 |
| Boise, US | 1 |
| Arcata, US | 1 |
| PrivatHerblocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| IB FRC Komi SC UB RASlocation not on record | 1 |
| Santa Barbara, US | 1 |
| Beijing, CN | 1 |
| Philadelphia, US | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Pittsburg, US | 1 |
| H-Schuhwlocation not on record | 1 |
| Lincoln, US | 1 |
| BClocation not on record | 1 |
| Nijmegen, NL | 1 |
| Chiba, JP | 1 |
| Clemson, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Fort Worth, US | 1 |
| Chicago, US | 1 |
173 institutions · 2 290 of 2 351 vouchered records shown · 48 without an institution code
09Environmental DNA9 detections
Where the DNA of Eleocharis ovata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found9
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 9 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.3 °C 10.0–20.4
Seasonal swing summer↔winter29.8 °C
Max temp (day)19.5 °C 15.7–24.8
Min temp (night)10.6 °C 3.10–16.6
Precipitation69.2 mm/mo 13.8–97.2
Air humidity55.0 % 45.7–61.1
Moisture balance-48.7 mm/mo -95.2–-21.2
Vapour deficit827 Pa 700–973
Wind speed3.50 m/s 2.10–4.50
Cloud cover40.1 % 24.1–45.3
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.