Eleocharis obtusa
(Willd.) Schult. · speciesAt a glance
Occurrence records6 523
Data sources12
Biological traits106
DNA specimens11
eDNA detections7
Sources12 archives
Databases and archives Eleocharis obtusa's data was compiled from.
WikipediaWikimedia Foundation2 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility6 523 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics11 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources106 traits
Occurrence & distributionGBIF6 523 records
Environmental DNA1 datasets · 1 countries7 detections
DNA & barcodingBOLD · NCBI11 specimens
Genome at a glanceCCDB · GIFT2n = 10
01Narrative
Eleocharis obtusa is a species of spikesedge known by the common name blunt spikerush. This plant is widely distributed across Canada and the United States, where it grows in wet areas such as riverbanks and moist forest floors. It is also a weed of rice paddies, especially when the rice plants are young sprouts. This is an annual spikesedge approaching half a meter in maximum height. It has many green cylindrical stems which are erect but weak and spongy. There may be thin, grasslike leaves toward the base of the plant, which are generally straw-colored. Atop each stem is a rounded or oblong spikelet containing at least ten flowers, each covered by an oval-shaped brown bract.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology10
Fruit length max1.5 mm
Fruit length min1 mm
Leaf length max60 mm
Leaf length min10 mm
Plant height0.49 m
⚠ sources differ — GIFT: 0.49 m · USDA: 0.488 m · TRY: 0.594 m
Plant height max0.4 m
Plant height min0.03 m
Seed mass0.147 mg
Seed mass max0.16 mg
Seed mass min0.136 mg
Life cycle & reproduction26
Bloom periodSummer
Coppice potentialNo
Deciduousnessn.d.
Dehiscenceindehiscent
Flower colouryellow
Flower conspicuousNo
Fruit seed period beginSpring
Fruit seed period endFall
Growth rate USDAModerate
Life formannual
Life spanannual
Lifespan categoryShort
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formtherophyte
Resprout abilityNo
Seed spread rateModerate
Seedling vigorMedium
Vegetative spread rateModerate
Diet & foraging1
Parasiteindependent
Habitat & environment27
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorDark Green
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit typeachene
Growth formherb
Growth form USDARhizomatous
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min10 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry22
Anaerobic toleranceMedium
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantYes
Fire toleranceMedium
Frost free days min120 days
Leaf dry-matter content (LDMC)270 mg/g
Leaf n18.2 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min18 in
Salinity toleranceNone
Shade toleranceHigh
Soil pH max8.7 pH
Soil pH min4.1 pH
Specific leaf area (SLA)13.45 mm²/mg
Temperature min37 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound2 834 953 per lb
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceYes
Planting density max4 800 per acre
Planting density min2 700 per acre
05DNA & barcoding11 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis obtusa has left across the world's sequence archives.
At a glance
DNA specimens11
Marker genes5
GenBank sequences10
eDNA detections7
Countries2
The DNA barcodea real sequence read deposited for this species
TTGCCTTTTTAAAACACGACCGGTGCACGAGTAAAGAAACGCTGCCGGGGAGGGCAACCTCCTCGGCTCCACCGGCCCCGAACAGCTCTC …
Eleocharis obtusa specimen-voucher S. D. Jones 2133 (TAES) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL4★rbcLa★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT
The complete instruction manual Eleocharis obtusa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 10 n = 5
Chromosome records10–102n range10median10mode12records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1012×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · cyper-only — Taylor, R. L. & G. A. Mulligan1968
CCDB · cyper-only — 251Schuyler, A. E.1977
CCDB · cyper-only — 252Schuyler, A. E.1977
CCDB · cyper-only — Gervais, C. & J. Cayouette1985
CCDB · ipcn-api-dl — GERVAIS, C. & J. Cayouette. 1985. Liste annotée de nombres chromosomiques de la flore vasculaire du nord-est de l'Amerique IV. Naturaliste Canad. 112: 319–331.
CCDB · ipcn-api-dl — Kiehn. 2005. Chromosome numbers of Hawaiian angiosperms: new records and comments. Pacific Sci. 59(3): 363–377.
CCDB · ipcn-api-dl — GERVAIS, C., M. Parent, R. Trahan & S. Plante. 1997. IOPB chromosome data 12. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 28: 16–18.
CCDB · ipcn-api-dl — Schuyler, A. E. 1977. Chromosome observations on some eastern North American Eleocharis (Cyperaceae). Brittonia 29: 129–133.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · eflora
GIFT · GIFT (floras)
n 57×CCDB · book-ipcn65 · CCDB · cyper-only · CCDB · book-ipcn67-71 +1
CCDB · book-ipcn65 — Raven et al. 1965
CCDB · cyper-only — Lewis, W. H., H. L. Stripling & R. G. Ross1962
CCDB · cyper-only — Harms, L. J.1964
CCDB · cyper-only — Raven, P. H.1965
CCDB · cyper-only — Taylor, R. L. & G. A. Mulligan1968
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · Cave1962 — Lewis et al. 1962
08Occurrence & distribution
Record type6 523 records
Wild obs. + sensor1 287
Museum / vouchered5 236
Origin
Native1
Introduced22
Range
Area of Occupancy AOO18 460 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy62% within 1 km
≤100 m 487≤1 km 71≤10 km 263>10 km 81
902 georeferenced · 385 without coordinates
Open the mapobservation + sensor1 287
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 253≤1 km 1 068≤10 km 1 450>10 km 314
3 085 georeferenced · 2 151 without coordinates
Open the institutions mapphysical evidence5 236
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions118 of 185 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Jackson, US | 398 |
| Chapel Hill, US | 311 |
| Bronx, US | 287 |
| Madison, US | 208 |
| Bangkok, TH | 197 |
| Philadelphia, US | 189 |
| Wuzhou, CN | 159 |
| Bloomington, US | 154 |
| Acadia Universitylocation not on record | 144 |
| St. Paul, US | 143 |
| Ann Arbor, US | 138 |
| University of New Hampshirelocation not on record | 133 |
| Chongqing Museumlocation not on record | 114 |
| Williamsburg, US | 107 |
| Burlington, US | 100 |
| Québec, CA | 91 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 89 |
| Austin, US | 84 |
| University of Stellenboschlocation not on record | 78 |
| New Haven, US | 72 |
| Corvallis, US | 66 |
| Valdosta State Universitylocation not on record | 62 |
| Green Bay, US | 59 |
| WTUlocation not on record | 58 |
| Pullman, US | 57 |
| Fort Worth, US | 56 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 51 |
| Toronto, CA | 49 |
| Jena Microbial Resource Collectionlocation not on record | 47 |
| Tampa, US | 46 |
| International Salmonella Centre (W.H.O.)location not on record | 46 |
| Montréal, CA | 45 |
| Fayetteville, US | 41 |
| Lord Fairfax Community Collegelocation not on record | 41 |
| Saint John, CA | 38 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 37 |
| Victoria, CA | 35 |
| Pittsburg, US | 35 |
| US | 34 |
| Université Lavallocation not on record | 34 |
| University of Southern Mississippilocation not on record | 31 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 26 |
| Tuscaloosa, US | 23 |
| Morgantown, US | 22 |
| Vancouver, CA | 21 |
| Columbia, US | 21 |
| GAlocation not on record | 21 |
| BAYLUlocation not on record | 20 |
| Norfolk, US | 20 |
| Saint Louis, US | 20 |
| Staten Island, US | 19 |
| Auckland, NZ | 19 |
| College Park, US | 18 |
| Mississippi State, US | 18 |
| Dekalb, US | 18 |
| Whitewater, US | 17 |
| Millersville, US | 17 |
| Portland, US | 16 |
| Knoxville, US | 16 |
| Durham, US | 15 |
| San Angelo, US | 13 |
| EL PASO, US | 13 |
| Little Rock, US | 12 |
| Museum of the Rockieslocation not on record | 11 |
| BISHlocation not on record | 11 |
| Canadian Department of Agriculturelocation not on record | 11 |
| DULlocation not on record | 11 |
| University of Wisconsinlocation not on record | 10 |
| Johnson City, US | 10 |
| Mohonk Preservelocation not on record | 10 |
| Flagstaff, US | 10 |
| Keene State Universitylocation not on record | 10 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 10 |
| Honolulu, US | 9 |
| DOI/NPS, Greenbelt Parklocation not on record | 9 |
| Clemson, US | 9 |
| Asheville, US | 9 |
| China Agricultural Universitylocation not on record | 8 |
| Provo, US | 8 |
| Riverside, US | 8 |
| Edmonton, CA | 8 |
| Chadron, US | 8 |
| University of Tennessee at Chattanoogalocation not on record | 7 |
| Davenport, US | 7 |
| AUAlocation not on record | 7 |
| Dover, US | 7 |
| Montréal, CA | 7 |
| ASUlocation not on record | 7 |
| Henderson State Universitylocation not on record | 6 |
| Zürich, CH | 6 |
| Christchurch, NZ | 6 |
| University of Wisconsinlocation not on record | 6 |
| MeiseBGlocation not on record | 6 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 6 |
| Adam Mickiewicz University in Poznańlocation not on record | 5 |
| Boise, US | 5 |
| WINlocation not on record | 5 |
| Denver, US | 5 |
| Moscow, US | 4 |
| Emporia, US | 4 |
| BIO-UNIPIlocation not on record | 4 |
| Fairfax, US | 4 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Lubbock, US | 4 |
| Phoenix, US | 4 |
| Wellington, NZ | 3 |
| Mount Pleasant, US | 3 |
| Angwin, US | 3 |
| Mexico City, MX | 3 |
| Spearfish, US | 3 |
| University of South Carolina Salkehatchielocation not on record | 3 |
| Claremont, US | 3 |
| CJBGlocation not on record | 3 |
| Fredericksburg, US | 3 |
| Washington, US | 3 |
| Armidale, AU | 3 |
| Northridge, US | 3 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Conway, US | 2 |
| Santa Barbara, US | 2 |
| Arcata, US | 2 |
| Oswego, US | 2 |
| Chicago, US | 2 |
| Miami, US | 2 |
| US | 2 |
| Allentown, US | 2 |
| IDElocation not on record | 2 |
| Logan, US | 2 |
| Davis, US | 2 |
| Cambridge, US | 2 |
| Moscow State Universitylocation not on record | 2 |
| Lausanne, CH | 2 |
| Lincoln, US | 2 |
| Hobart, AU | 2 |
| Denton, US | 2 |
| Conway, US | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| McGill Universitylocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Ypsilanti, US | 1 |
| Portland, US | 1 |
| STNFlocation not on record | 1 |
| San Luis Obispo, US | 1 |
| University of Winnipeglocation not on record | 1 |
| Oskarshamn, SE | 1 |
| Xiamen, CN | 1 |
| Paris, FR | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Hamilton, US | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Porto Alegre, BR | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Brookings, US | 1 |
| UnBlocation not on record | 1 |
| UFMSlocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| Durham, US | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 1 |
| Guasave, MX | 1 |
| Long Beach, US | 1 |
| Bend, US | 1 |
| Pelotas, BR | 1 |
| Macomb, US | 1 |
| Caldwell, US | 1 |
| Bogotá, D.C., CO | 1 |
| Pocatello, US | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Chicago, US | 1 |
| USFS/BHSClocation not on record | 1 |
| BClocation not on record | 1 |
| San Diego, US | 1 |
| Due West, US | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Chicago, US | 1 |
| Berlin, DE | 1 |
| South Kensington, GB | 1 |
| Brussel, BE | 1 |
| Appalachian State Universitylocation not on record | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
185 institutions · 5 003 of 5 236 vouchered records shown · 233 without an institution code
09Environmental DNA7 detections
Where the DNA of Eleocharis obtusa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map1 country0
Managed boreal mixedwood stand
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.6 °C 15.5–20.6
Seasonal swing summer↔winter32.5 °C
Max temp (day)22.8 °C 20.6–25.1
Min temp (night)14.1 °C 11.9–16.4
Precipitation93.1 mm/mo 86.2–106
Air humidity59.2 % 57.8–59.4
Moisture balance-20.6 mm/mo -48.6–-2.70
Vapour deficit822 Pa 720–1,025
Wind speed3.00 m/s 2.60–3.60
Cloud cover44.8 % 41.5–54.5
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.