Eleocharis nitida

Fernald · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Eleocharis

At a glance

Occurrence records139

Data sources8

Biological traits10

DNA specimens6

eDNA detections4

Sources8 archives

Databases and archives Eleocharis nitida's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility139 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF139 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Eleocharis nitida is a species of flowering plant commonly called neat spikerush, it is a member of the sedge family Cyperaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis nitida has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences8

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG215710.1 ↗298 bpCanada · 1954

ACGT

AGTTGCGCCCGAGGGACCATCCCGAGGGCACGCCTGCCTGGGCGTTAGAAGCCCATCCACGCTCGGCGCACGCCCGATGCGGACAATGGC …

Eleocharis nitida voucher CCDB-18294-E08 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type139 records

Wild obs. + sensor54

Museum / vouchered85

Range

Area of Occupancy AOO428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 26≤1 km 3>10 km 15

44 georeferenced · 10 without coordinates

Open the mapobservation + sensor54

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 3≤1 km 5≤10 km 14>10 km 3

25 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence85

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Acadia Universitylocation not on record	14
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	7
Québec, CA	7
Montréal, CA	7
Université Lavallocation not on record	7
Vancouver, CA	5
Madison, US	5
Chongqing Museumlocation not on record	4
University of Wisconsinlocation not on record	4
Ann Arbor, US	3
Toronto, CA	3
Ypsilanti, US	2
GAlocation not on record	1
Wuzhou, CN	1
Whitehorse, CA	1
Chicago, US	1
Tampa, US	1
WTUlocation not on record	1
Victoria, CA	1
San Angelo, US	1
Auckland, NZ	1
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	1
Bloomington, US	1

23 institutions · 79 of 85 vouchered records shown · 6 without an institution code

09Environmental DNA4 detections

Where the DNA of Eleocharis nitida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Forming tight sward-like clumps at edge of w…In small to large rounded tufts along peaty …Damp roadside on basalt.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 17.7–17.7

Seasonal swing summer↔winter32.0 °C

Max temp (day)22.7 °C

Min temp (night)14.7 °C

Precipitation93.0 mm/mo

Air humidity58.9 %

Moisture balance-42.8 mm/mo

Vapour deficit835 Pa

Wind speed2.90 m/s

Cloud cover39.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)