Eleocharis gracilis

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Eleocharis

At a glance

Occurrence records1 908

Data sources8

Biological traits37

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Eleocharis gracilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 908 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF1 908 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Eleocharis gracilis ou souchet gracile est une plante de type jonc élancée qui pousse de 20 à 50 cm de haut, atteignant rarement 1 m de haut. On la trouve en petites touffes, poussant dans des milieux saisonnièrement humides dans de nombreuses régions du sud-est de l'Australie et de la Nouvelle-Zélande. L'épithète spécifique gracilis provient du latin et fait référence à son apparence élancée. C'est l'une des nombreuses plantes décrites pour la première fois par Robert Brown, dont le type est connu sous la mention « (J.) v.v. », dans son ouvrage Prodromus Florae Novae Hollandiae et Insulae Van Diemen de 1810.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology12

Fruit length1.25 mm

Fruit width0.9 mm

Leaf size393 mm²

Plant height0.15 m

⚠ sources differ — GIFT: 0.15 m · AusTraits: 0.25 m

Plant height max0.2 m

Seed length1.25 mm

⚠ sources differ — AusTraits: 1.25 mm · GIFT: 1.5 mm

Seed length max1.5 mm

Seed length min1.5 mm

Seed mass0.342 mg

⚠ sources differ — TRY: 0.342 mg · AusTraits: 0.508 mg · GIFT: 0.34 mg

Seed mass max0.5 mg

Seed mass min0.18 mg

Seed width0.8 mm

Life cycle & reproduction12

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life formperennial

Life spanperennial

Pollination modeabiotic

Pollination syndromeinsect+wind

⚠ sources differ — AusTraits: insect wind · GIFT: wind

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Habitat GIFTLowland

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition7 compounds

Compounds documented for Eleocharis gracilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Noreudesmane sesquiterpenoids3

Aromatic polyketides with side chains1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
2-Acetyl-4,8-dihydro-5-methylbenzo[1,2-b:5,4-b']difuran-4,8-dione	present	LOTUS
2-Prop-1-en-2-ylfuro[3,2-f][1]benzofuran-4,8-dione	present	LOTUS
3-[(Z)-heptadec-8-enyl]-2-hydroxy-5-methoxycyclohexa-2,5-diene-1,4-dione	present	LOTUS
5-Methyl-2-prop-1-en-2-yl-2,3,5,6-tetrahydrofuro[3,2-f][1]benzofuran-4,8-dione	present	LOTUS
BENZO(1,2-b:5,4-b')DIFURAN-4,8-DIONE, 2,3-DIHYDRO-2-ISOPROPENYL-5-METHYL-, (-)-	present	LOTUS
Benzo[1,2-b:5,4-b']difuran-4,8-dione, 2-[1-(hydroxymethyl)vinyl]-5-methyl-	present	LOTUS
Cyperaquinone	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis gracilis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU110823.1 ↗610 bp

ACGT

TTGTTGCCTTTTGAAACACGACCGGTGCACGAGTAAAGAAACGCTGCCGGGGAGGGCAACCTCCTCGGCTCCACCGGCCCCGAACAGCTC …

Eleocharis gracilis voucher R. Bates 9100 (TEX) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eleocharis gracilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome records20–202n range20median20mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 204×CCDB · new-zealand · CCDB · cyper-only · CCDB · ipcn-api-dl +1

CCDB · new-zealand

CCDB · cyper-only — Briggs, B. G.1970

CCDB · ipcn-api-dl — de Lange, P. J., B. G. Murray & P. M. Datson. 2004. Contributions to a chromosome atlas of the New Zealand flora---38. Counts for 50 families. New Zealand J. Bot. 42: 873–904.

CCDB · book-ipcn67-71 — BRIGGS, B.G. 1970. Chromosome numbers in some Australian species of Eleocharis (Cyperaceae). Contr. New South Wales Natl. Herb. 4: 130-136.

08Occurrence & distribution

Record type1 908 records

Wild obs. + sensor913

Museum / vouchered995

Origin

Native294

Range

Area of Occupancy AOO5 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 527≤1 km 206≤10 km 119>10 km 5

857 georeferenced · 56 without coordinates

Open the mapobservation + sensor913

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 59≤1 km 136≤10 km 233>10 km 41

469 georeferenced · 526 without coordinates

Open the institutions mapphysical evidence995

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	278
Auckland, NZ	135
Museo Entomologico de Leonlocation not on record	114
Mount Annan, AU	96
Adelaide, AU	82
Wellington, NZ	81
Hobart, AU	59
Brisbane, AU	39
Canberra, AU	37
Rotorua, NZ	24
Armidale, AU	12
Palmerston North, NZ	5
QVMAGlocation not on record	5
Palmerston, AU	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
John T. Waterhouse Herbariumlocation not on record	3
Wollongong, AU	3
Batemans Bay, AU	2
EL PASO, US	1
Stockholm, SE	1
Taipei, TW	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
University of Stellenboschlocation not on record	1

23 institutions · 987 of 995 vouchered records shown · 8 without an institution code

09Environmental DNA4 detections

Where the DNA of Eleocharis gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eleocharis gracilis

At a glance

Sources8 archives

Size & morphology12

Life cycle & reproduction12

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

Compound class profile2 classes

Documented compounds7 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 908 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 908 records