Eleocharis geniculata
(L.) Roem. & Schult. · speciesAt a glance
Occurrence records6 065
Data sources14
Biological traits47
DNA specimens27
eDNA detections14
Sources14 archives
Databases and archives Eleocharis geniculata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility6 049 records↗
OBISOcean Biodiversity Information System16 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics27 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources47 traits
Chemical compositionLOTUS11 compounds
Occurrence & distributionGBIF · OBIS6 065 records
Environmental DNA1 datasets · 4 countries14 detections
DNA & barcodingBOLD · NCBI27 specimens
Genome at a glanceCCDB · GIFT · GoaT698 Mbp
01Narrative
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology17
Fruit length1 mm
Fruit length max1 mm
Fruit width0.8 mm
Leaf length max40 mm
Leaf length min5 mm
Leaf size1 896 mm²
Leaf width max40 mm
Plant height0.4 m
⚠ sources differ — AusTraits: 0.4 m · TRY: 0.66 m
Plant height generative0.239 m
Plant height max0.5 m
Plant height min0 m
Seed mass0.118 mg
⚠ sources differ — TRY: 0.118 mg · AusTraits: 0.109 mg · GIFT: 0.116 mg
Seed mass max0.149 mg
Seed mass min0.08 mg
Seed volume0.26 mm³
Seed volume max0.26 mm³
Seed volume min0.26 mm³
Life cycle & reproduction9
Deciduousnessn.d.
Dehiscenceindehiscent
Dispersal typewater
⚠ sources differ — AusTraits: hydrochory · GIFT: zoochorous
Flowering timeyynnnnnnyyyy
Life formannual
Life spanannual
Pollination syndromeinsect+wind
Raunkiær life formtherophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatesubtropical or tropical
Climberself-supporting
Elevation max2 000 m
Elevation mean925 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typenut
⚠ sources differ — AusTraits: nut · GIFT: achene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFTÁrea Antrópica, Campo Limpo, Restinga, Vegetação Aquática
Mycorrhiza type0.000844375
Succulenceno
Woodinessnon-woody
Physiology & chemistry6
Leaf c410 mg/g
Leaf dry-matter content (LDMC)187 mg/g
Leaf n16.53 mg/g
Leaf p2.34 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)11.59 mm²/mg
03Chemical composition11 compounds
Compounds documented for Eleocharis geniculata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Flavones3
Noreudesmane sesquiterpenoids3
Aromatic polyketides with side chains1
Anthocyanidins1
Documented compounds11 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 2-Acetyl-4,8-dihydro-5-methylbenzo[1,2-b:5,4-b']difuran-4,8-dione | present | LOTUS | |
| 2-Prop-1-en-2-ylfuro[3,2-f][1]benzofuran-4,8-dione | present | LOTUS | |
| 3-[(Z)-heptadec-8-enyl]-2-hydroxy-5-methoxycyclohexa-2,5-diene-1,4-dione | present | LOTUS | |
| 5-Methyl-2-prop-1-en-2-yl-2,3,5,6-tetrahydrofuro[3,2-f][1]benzofuran-4,8-dione | present | LOTUS | |
| BENZO(1,2-b:5,4-b')DIFURAN-4,8-DIONE, 2,3-DIHYDRO-2-ISOPROPENYL-5-METHYL-, (-)- | present | LOTUS | |
| Benzo[1,2-b:5,4-b']difuran-4,8-dione, 2-[1-(hydroxymethyl)vinyl]-5-methyl- | present | LOTUS | |
| Cyanidin | present | LOTUS | |
| Cyperaquinone | present | LOTUS | |
| Luteolin 5-methyl ether | present | LOTUS | |
| Luteolin 7-diglucoside | present | LOTUS |
05DNA & barcoding27 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis geniculata has left across the world's sequence archives.
At a glance
DNA specimens27
Marker genes8
GenBank sequences10
eDNA detections14
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCATCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …
Eleocharis geniculata voucher CCDB-18345-G10 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS2atpF-atpHpsbK-psbIrpoC1
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Eleocharis geniculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size698 489 096 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Eleocharis geniculata0.70 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 10 n = 5
Ploidy2× diploid · measured
Chromosome records10–802n range20median10mode30records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1011×GoaT · Kew Plant DNA C-values Database · CCDB · cyper-only · CCDB · ipcn-api-dl +4
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · cyper-only — Tuspule, S. H.1966
CCDB · cyper-only — 247Briggs, B. G.1970
CCDB · cyper-only — Nijalingappa, B. H. M.1972
CCDB · cyper-only — 247Kessler, J. W.1983
CCDB · ipcn-api-dl — Kessler, J. W. 1983. In IOPB chromosome number reports LXXIX. 32: 322–323.
CCDB · book-ipcn72 — NIJALINGAPPA, B.H.M. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · book-ipcn67-71 — BRIGGS, B.G. 1970. Chromosome numbers in some Australian species of Eleocharis (Cyperaceae). Contr. New South Wales Natl. Herb. 4: 130-136.
CCDB · book-indian_vol2 — Nijalingappa, B.H.M. 1972, 1973c
CCDB · book-indian_vol2 — Tuspule, S.H. 1966
GIFT · GIFT (floras)
2n 2011×GoaT · Kew Plant DNA C-values Database · CCDB · cyper-only · CCDB · ipcn-api-dl +3
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · cyper-only — Sharma, A. K. & A. K. Sarkar19671968
CCDB · cyper-only — 246Sharma, A. K. & A. K. Sarkar19671968
CCDB · cyper-only — 246Sharma, A. K.1970
CCDB · cyper-only — Sanyal, B. & A. Sharma1972a
CCDB · cyper-only — 246Sanyal, B. & A. Sharma1972a
CCDB · ipcn-api-dl — Pedrosa, A. 1999. Citogenética de angiospermas coletadas em Pernambuco - V. Acta Bot. Brasil. 13(1): 49–60.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.
CCDB · book-indian_vol2 — Sharma, A. & Sarkar, A.K. 1967- 1968 ; Sanyal, B. & Sharma, A. 1972
GIFT · GIFT (floras)
2n 384×CCDB · cyper-only · CCDB · book-indian_vol2 · CCDB · book-fedorov +1
CCDB · cyper-only — Hicks, G. C.1929
CCDB · book-indian_vol2 — Hicks, G.C. 1929
CCDB · book-fedorov — Hicks 1929
GIFT · GIFT (floras)
2n 302×CCDB · book-indian_vol2 · GIFT · GIFT (floras)
CCDB · book-indian_vol2 — Rath, S.P. & Patnaik, S.N. 1978a, b
GIFT · GIFT (floras)
2n 802×CCDB · cyper-only · CCDB · ipcn-api-dl
CCDB · cyper-only — 246Subramanian, D.1988
CCDB · ipcn-api-dl — Subramanian, D. 1988. Cytotaxonomical studies in south Indian Cyperaceae I. Species from the plains. Cytologia 53: 67–72.
n 152×CCDB · cyper-only · CCDB · ipcn-api-dl
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1978b
CCDB · ipcn-api-dl — Rath, S. P. & S. N. PATNAIK. 1978. Cytological studies in Cyperaceae. Proc. Indian Sci. Congr. Assoc. (III, C) 65: 107–108.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
08Occurrence & distribution
Record type6 065 records
Wild obs. + sensor795
Museum / vouchered5 053
Cultivated / captive2
Other215
Origin
Native839
Introduced1
Range
Area of Occupancy AOO13 936 km²
Depth
0–200 m sunlit8
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 1 m · max 1 m · 8 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy83% within 1 km
≤100 m 386≤1 km 68≤10 km 29>10 km 63
546 georeferenced · 249 without coordinates
Open the mapobservation + sensor795
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy59% within 1 km
≤100 m 773≤1 km 137≤10 km 511>10 km 120
1 541 georeferenced · 3 512 without coordinates
Open the institutions mapphysical evidence5 053
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions146 of 288 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 263 |
| Bronx, US | 236 |
| Durango, MX | 170 |
| Brisbane, AU | 167 |
| Mexico City, MX | 164 |
| Palmerston, AU | 126 |
| Kew, GB | 125 |
| Université de Bordeauxlocation not on record | 123 |
| Masindi, UG | 122 |
| Austin, US | 120 |
| Universidade Federal de Sergipe (UFS)location not on record | 106 |
| Tampa, US | 105 |
| Mount Annan, AU | 104 |
| UNIVASFlocation not on record | 101 |
| University of Stellenboschlocation not on record | 91 |
| San Diego, US | 89 |
| Jena Microbial Resource Collectionlocation not on record | 86 |
| Kensington, AU | 67 |
| Ann Arbor, US | 61 |
| Miami, US | 61 |
| Universidade Federal do Vale do São Franciscolocation not on record | 59 |
| ASUlocation not on record | 56 |
| Salvador, BR | 55 |
| Guasave, MX | 54 |
| Ciudad de México, MX | 53 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 52 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 51 |
| Porto Alegre, BR | 50 |
| Riverside, US | 47 |
| MeiseBGlocation not on record | 47 |
| Canberra, AU | 41 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 40 |
| National Biodiversity Institute, Costa Ricalocation not on record | 40 |
| Museo Entomologico de Leonlocation not on record | 39 |
| Mérida, MX | 38 |
| La Paz, MX | 37 |
| Fort Worth, US | 35 |
| UFBAlocation not on record | 32 |
| JBRJlocation not on record | 32 |
| UFPElocation not on record | 31 |
| Chapel Hill, US | 31 |
| Juriquilla, MX | 31 |
| UFERSAlocation not on record | 30 |
| UnBlocation not on record | 30 |
| Honolulu, US | 26 |
| St. Augustine, TT | 26 |
| UFMSlocation not on record | 26 |
| UFESlocation not on record | 25 |
| Xiamen, CN | 25 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 24 |
| Federal University of Espírito Santolocation not on record | 24 |
| Smithfield, AU | 24 |
| Montréal, CA | 23 |
| Claremont, US | 23 |
| Flagstaff, US | 21 |
| Departamento de Sistematica e Ecologialocation not on record | 21 |
| Chaguaramas, TT | 20 |
| Jackson, US | 20 |
| Pontifícia Universidade Católica do Paranálocation not on record | 19 |
| UFSClocation not on record | 18 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 18 |
| Laboratorio de Ictiologialocation not on record | 18 |
| Universidade Federal de Santa Catarinalocation not on record | 17 |
| IECOSlocation not on record | 17 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 16 |
| Universidade Federal do Maranhãolocation not on record | 16 |
| Nishihara, JP | 15 |
| Austin, US | 15 |
| Fortaleza, BR | 15 |
| Universidade Federale do Rio Grande do Sullocation not on record | 15 |
| Armidale, AU | 14 |
| Christchurch, NZ | 14 |
| CASlocation not on record | 14 |
| BISHlocation not on record | 14 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 13 |
| Wuzhou, CN | 13 |
| San Francisco de Campeche, MX | 13 |
| CEPLAClocation not on record | 13 |
| LBVlocation not on record | 12 |
| USP-IBlocation not on record | 12 |
| Cuiabá, BR | 12 |
| James Cook Townsvillelocation not on record | 11 |
| Adelaide, AU | 11 |
| Guangzhou, CN | 11 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 11 |
| Forest Herbarium Ibadan (FHI)location not on record | 11 |
| Altos de Pipe, VE | 10 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 10 |
| Valdosta State Universitylocation not on record | 10 |
| Hermosillo, MX | 10 |
| Taipei, TW | 9 |
| MAlocation not on record | 9 |
| Cenargenlocation not on record | 9 |
| BAYLUlocation not on record | 9 |
| Edinburgh, GB | 9 |
| Universidade Federal de Goiáslocation not on record | 9 |
| Ciudad de México, MX | 8 |
| Auckland, NZ | 8 |
| Chapingo, MX | 8 |
| UFRPElocation not on record | 8 |
| South Kensington, GB | 8 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 8 |
| Ilhéus, BR | 8 |
| Tuscaloosa, US | 8 |
| Vancouver, CA | 8 |
| Phoenix, US | 8 |
| Tuxtla Gutiérrez, MX | 8 |
| Paris, FR | 8 |
| UEPAlocation not on record | 8 |
| Herbier National du Gabonlocation not on record | 8 |
| Chongqing Museumlocation not on record | 8 |
| Feira de Santana, BR | 7 |
| Taipei, TW | 7 |
| UNESP-RClocation not on record | 7 |
| Puerto Ayora, EC | 7 |
| Brasília, BR | 7 |
| Brasília, BR | 7 |
| Bloomington, US | 7 |
| WAGlocation not on record | 7 |
| Chicago, US | 7 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 6 |
| Berlin, DE | 6 |
| León, NI | 6 |
| Wlocation not on record | 6 |
| Corrientes, AR | 6 |
| Pullman, US | 6 |
| Universidad Nacional de Colombia (UNAL)location not on record | 6 |
| UNICAMPlocation not on record | 6 |
| Stockholm, SE | 6 |
| San José, CR | 6 |
| EL PASO, US | 6 |
| Tapachula, MX | 6 |
| IPA/SPlocation not on record | 6 |
| Durham, US | 6 |
| Culiacán, MX | 5 |
| TAIElocation not on record | 5 |
| Pretoria, ZA | 5 |
| Ensenada, MX | 5 |
| Autlán de Navarro, MX | 5 |
| BMlocation not on record | 5 |
| Museum of Zoologylocation not on record | 5 |
| Plocation not on record | 5 |
| Davis, US | 4 |
| Arizona State University Biocollectionslocation not on record | 4 |
| Aarhus, DK | 4 |
| Tsukuba, JP | 4 |
| Bangkok, TH | 4 |
| Cambridge, US | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| GeoPark Colombia S.A.S (GeoPark)location not on record | 4 |
| Knoxville, US | 4 |
| Santa Barbara, US | 4 |
| San Angelo, US | 4 |
| Victoria, CA | 4 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 4 |
| Guatemala City, GT | 4 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 4 |
| Tall Timbers Research Stationlocation not on record | 3 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 3 |
| Uppsala, SE | 3 |
| Beijing, CN | 3 |
| UEMlocation not on record | 3 |
| Bogotá, D.C., CO | 3 |
| US | 3 |
| Pontifícia Universidade Católica do Paranálocation not on record | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| Calabar, NG | 3 |
| Mérida, MX | 3 |
| Sangmiung Universitylocation not on record | 3 |
| Burlington, US | 3 |
| UNITINSlocation not on record | 3 |
| CPATSAlocation not on record | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 3 |
| San Isidro, AR | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Columbia, US | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| Maringá, BR | 3 |
| Londrina, BR | 3 |
| Albuquerque, US | 3 |
| San Jose, US | 2 |
| Loja, EC | 2 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 2 |
| Leiden University Medical Centerlocation not on record | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| WTUlocation not on record | 2 |
| Guilin, CN | 2 |
| Criciúma, BR | 2 |
| Paleontological Collectionlocation not on record | 2 |
| Los Angeles, US | 2 |
| CJBGlocation not on record | 2 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 2 |
| UFOPlocation not on record | 2 |
| Antiguo Cuscatlán, SV | 2 |
| UEMAlocation not on record | 2 |
| Sucre, BO | 2 |
| Montpellier, FR | 2 |
| Staten Island, US | 2 |
| VENlocation not on record | 2 |
| Elocation not on record | 2 |
| The University of Arizonalocation not on record | 2 |
| Blumenau, BR | 2 |
| HNBlocation not on record | 2 |
| GB | 2 |
| Eduardo Mondlane Universitylocation not on record | 2 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 2 |
| Mazatlán, MX | 2 |
| Yaoundé, CM | 2 |
| Tlalnepantla, MX | 2 |
| Cruz das Almas, BR | 2 |
| UFPRlocation not on record | 2 |
| Université du Lomélocation not on record | 2 |
| GAlocation not on record | 2 |
| Toronto, CA | 2 |
| UNESClocation not on record | 2 |
| Ivano-Frankivsk, UA | 2 |
| Frankfurt am Main | 2 |
| HACAMlocation not on record | 1 |
| UESBlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| LDlocation not on record | 1 |
| BGPAlocation not on record | 1 |
| Universidad Pablo de Olavidelocation not on record | 1 |
| Zacatecas, MX | 1 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 1 |
| DanBIFlocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Hobart, AU | 1 |
| Mississippi State, US | 1 |
| PUC-RIOlocation not on record | 1 |
| UFMGlocation not on record | 1 |
| University of Iowalocation not on record | 1 |
| BRLUlocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Oswego, US | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| QCNElocation not on record | 1 |
| Université de Strasbourglocation not on record | 1 |
| Museu Paraense Emilio Goeldilocation not on record | 1 |
| Pondicherry, IN | 1 |
| Salamanca, ES | 1 |
| Arcata, US | 1 |
| MEXUlocation not on record | 1 |
| Mexico City, MX | 1 |
| Museum of the Rockieslocation not on record | 1 |
| San Francisco, US | 1 |
| HEMlocation not on record | 1 |
| Moscow, US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| Whitehorse, CA | 1 |
| Indian Institute of Science (IISc)location not on record | 1 |
| Little Rock, US | 1 |
| International Salmonella Centre (W.H.O.)location not on record | 1 |
| Gump Stationlocation not on record | 1 |
| Asheville, US | 1 |
| Olocation not on record | 1 |
| GENTlocation not on record | 1 |
| Guatemala, GT | 1 |
| Universidade do Vale do Itajaílocation not on record | 1 |
| Denton, US | 1 |
| Arizona Western Collegelocation not on record | 1 |
| Glocation not on record | 1 |
| Madison, US | 1 |
| Quito, EC | 1 |
| LGlocation not on record | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| AUAlocation not on record | 1 |
| OTSlocation not on record | 1 |
| Campo Grande, BR | 1 |
| Teresina, BR | 1 |
| URCAlocation not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| US | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| Northridge, US | 1 |
| Irvine, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Denver, US | 1 |
| UFRRJlocation not on record | 1 |
| Dekalb, US | 1 |
288 institutions · 4 901 of 5 053 vouchered records shown · 145 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA14 detections
Where the DNA of Eleocharis geniculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found14
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 14 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median26.0 °C 23.7–26.2
Seasonal swing summer↔winter2.10 °C
Max temp (day)28.2 °C 26.9–28.7
Min temp (night)23.8 °C 20.8–24.2
Precipitation227 mm/mo 103–299
Air humidity65.5 % 60.4–68.7
Moisture balance46.5 mm/mo -61.8–145
Vapour deficit1,178 Pa 1,012–1,214
Wind speed3.20 m/s 1.20–3.40
Cloud cover30.6 % 29.9–49.0
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.