Eleocharis cylindrostachys

Boeckeler · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Eleocharis

At a glance

Occurrence records566

Data sources9

Biological traits31

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Eleocharis cylindrostachys's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility566 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF566 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Eleocharis cylindrostachys is a rush type plant growing in dense clumps from 40 to 60 cm tall. Found growing in moist situations in New South Wales and Queensland, Australia. The specific epithet cylindrostachys is derived from Latin and refers to “a cylindrical head of corn”.Les Robinson – Field Guide to the Native Plants of Sydney, page 287

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology9

Fruit length1.18 mm

Fruit width0.8 mm

Leaf length max1.5 mm

Leaf length min1 mm

Leaf width max1.5 mm

Leaf width min1 mm

Seed mass0.161 mg

Seed mass max0.16 mg

Seed mass min0.16 mg

Life cycle & reproduction9

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life formperennial

Life spanperennial

Pollination syndromeabiotic

Raunkiær life formhemicryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Habitat GIFTwetland vegetation

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Eleocharis cylindrostachys across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Anthocyanidins5

Aurones1

Flavonols1

Flavones1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
Aureusidin	present	LOTUS
Cyanidin	present	LOTUS
Delphinidin 3-xyloside 7-rhamnosylglucoside	present	LOTUS
Pelargonidin	present	LOTUS
Quercetin	present	LOTUS
Tricin	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis cylindrostachys has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU110793.1 ↗606 bp

ACGT

TTGTTGCCTTTTGAAAACACGACCGTGCACGAGTAAAAAACGCTGCCGGGGAGGGAAACCTCCTCGGCTCCACCGACCCCGAACAGCTCT …

Eleocharis cylindrostachys voucher C. E. Hinchliff 93 (WS) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eleocharis cylindrostachys carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BRIGGS, B.G. 1970. Chromosome numbers in some Australian species of Eleocharis (Cyperaceae). Contr. New South Wales Natl. Herb. 4: 130-136.

08Occurrence & distribution

Record type566 records

Wild obs. + sensor124

Museum / vouchered398

Other44

Origin

Native110

Range

Area of Occupancy AOO1 604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 75≤1 km 33≤10 km 11>10 km 1

120 georeferenced · 4 without coordinates

Open the mapobservation + sensor124

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 91≤1 km 16≤10 km 157>10 km 56

320 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence398

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	179
Mount Annan, AU	110
Museo Entomologico de Leonlocation not on record	24
Armidale, AU	22
Université de Strasbourglocation not on record	16
Kew, GB	8
John T. Waterhouse Herbariumlocation not on record	6
Canberra, AU	6
Paris, FR	5
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Pullman, US	3
Smithfield, AU	3
UnBlocation not on record	2
Palmerston, AU	2
Beijing, CN	1
Hobart, AU	1
James Cook Townsvillelocation not on record	1
University of Stellenboschlocation not on record	1
Christchurch, NZ	1
Auckland, NZ	1

20 institutions · 395 of 398 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Eleocharis cylindrostachys was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)