Eleocharis bifida

S.G.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Eleocharis

At a glance

Occurrence records86

Data sources7

Biological traits10

DNA specimens1

eDNA detections2

Sources7 archives

Databases and archives Eleocharis bifida's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility86 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF86 records

Environmental DNA2 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Eleocharis bifida is a species of spikesedge known by the common name glade spikerush. It is native to the Eastern United States, where it is endemic to the Interior Low Plateau and very small part of the Ridge and Valley ecoregions. This is mostly in Kentucky and Tennessee, extending into southern Indiana, northern Alabama, and northwestern Georgia.Kew World Checklist of Selected Plant FamiliesBiota of North America Program, 2013 county distribution map It is found only in wet areas in cedar glades, such as pools and streamsides. This narrow habitat requirement is the reason for it being considered vulnerable. Eleocharis bifida was described to science in 2001, being separated from the similar Eleocharis compressa. Eleocharis bifida can be recognized by having wider stems and all floral scales bifid (2-lobed).Flora of North America

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis bifida has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU110764.1 ↗594 bp

ACGT

TTGTTGCCTTTTGAAAACACGACCGGTGCACGAGTAAAGAAACGCTGCCGGGGAGGGCAACCTCCTCGGCTCCACCGGCCCCGAACAGCA …

Eleocharis bifida voucher V. E. McNeilus 88-518 (TAES) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

08Occurrence & distribution

Record type86 records

Wild obs. + sensor71

Museum / vouchered15

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 42≤1 km 5≤10 km 2>10 km 8

57 georeferenced · 14 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 2≤1 km 6≤10 km 3

11 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Tennessee at Chattanoogalocation not on record	4
Chapel Hill, US	3
Bloomington, US	3
Tuscaloosa, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Wuzhou, CN	1
Jackson, US	1
AUAlocation not on record	1

8 institutions · 15 of 15 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Eleocharis bifida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.4 °C 12.4–12.4

Seasonal swing summer↔winter21.3 °C

Max temp (day)14.2 °C

Min temp (night)10.7 °C

Precipitation67.2 mm/mo

Air humidity62.8 %

Moisture balance-14.2 mm/mo

Vapour deficit536 Pa

Wind speed6.40 m/s

Cloud cover42.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)