Eleocharis acicularis
(L.) Roem. & Schult. · speciesAt a glance
Occurrence records54 759
Data sources11
Biological traits121
DNA specimens59
eDNA detections34
Sources11 archives
Databases and archives Eleocharis acicularis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility54 759 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics59 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources121 traits
Occurrence & distributionGBIF54 759 records
Environmental DNA1 datasets · 6 countries34 detections
DNA & barcodingBOLD · NCBI59 specimens
Genome at a glanceCCDB · GoaT702 Mbp
01Narrative
Eleocharis acicularis, de noms vernaculaires Scirpe épingle ou Héléocharis épingle, est une espèce de plantes herbacées du genre Eleocharis, de la famille des Cyperaceae. C'est une plante vivace en culture immergée, mais une plante annuelle en culture émergée.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology13
Leaf mass0.2 mg
Leaf size13.25 mm²
Plant height0.135 m
⚠ sources differ — GIFT: 0.135 m · LEDA: 0.06 m · USDA: 0.213 m · TRY: 0.1 m
Plant height generative0.06 m
Plant height max0.2 m
Plant height min0.02 m
Seed length1 mm
Seed mass0.044 mg
⚠ sources differ — TRY: 0.044 mg · LEDA: 0.075 mg · GIFT: 0.208 mg
Seed mass max0.044 mg
Seed mass min0.044 mg
Seed volume0.035 mm³
Seed volume max0.035 mm³
Seed volume min0.035 mm³
Life cycle & reproduction35
After harvest regrowth rateSlow
Bloom periodMid Summer
Coppice potentialNo
Deciduousnessn.d.
⚠ sources differ — TRY: n.d. · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourwhite
Flower conspicuousNo
Flowering endOct
Flowering startJun
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formhelophyte or perennial
Life spanperennial
Lifespan categoryModerate
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: cryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number5
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Vegetative spread rateRapid
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment29
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 725 m
Elevation mean2 600 m
Elevation min1 240 m
Epiphyteterrestrial
Foliage porosity summerPorous
Foliage porosity winterPorous
Fruit colourbrown
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Growth form USDARhizomatous
Habitat GIFTshores, swamps
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min10 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry22
Anaerobic toleranceMedium
C:N ratioMedium
Caco3 toleranceLow
Cold stratification requiredYes
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min110 days
Leaf dry-matter content (LDMC)150 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max50 in
Precipitation min14 in
Salinity toleranceMedium
Seed longevity index0.25
Shade toleranceHigh
Soil pH max7 pH
Soil pH min4.5 pH
Specific leaf area (SLA)75.27 mm²/mg
Temperature min-23 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound900 000 per lb
ToxicityNone
Veneer productNo
Other traits7
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max4 800 per acre
Planting density min1 700 per acre
05DNA & barcoding59 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eleocharis acicularis has left across the world's sequence archives.
At a glance
DNA specimens59
Marker genes7
GenBank sequences10
eDNA detections34
Countries7
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCATCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …
Eleocharis acicularis voucher NMW3109 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL6★rbcLa★trnL-F★ITS1★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Eleocharis acicularis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size701 715 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Eleocharis acicularis0.70 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Chromosome records18–202n range20median20mode41records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2039×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — FICINI G., GARBARI F., GIORDANI A., TOMEI P.E. - 1980. Numeri cromosomici per la flora italiana:683-689.. Inform. Bot. Ital. , 12(2): 113-116.
CCDB · slov-fl — Uhríková A. & Feráková V., 1978: [Report], pp. 379. - In: Löve Á. (ed.), IOPB Chromosome Number Reports LXI, Taxon 27 /4.
CCDB · iber-fl — Cytotaxonomy of spanish plants. II. Monocotyledons. Lve, A. & E. Kjellqvist.Lagascalia3(2): 147-182(1973).
CCDB · fl-europaea — LOve & Love, 1956
CCDB · cyper-only — Tanaka, N.1937
CCDB · cyper-only — Lve, . & D. Lve1956
CCDB · cyper-only — Jorgensen, C. A., T. Sorensen & M. Westergaard1958
CCDB · cyper-only — Taylor, R. L. & G. A. Mulligan1968
CCDB · cyper-only — Thiebaud, M.-A.1970
CCDB · cyper-only — Lve, . & E. Kjellqvist1973
CCDB · cyper-only — Zhukova, P. G. & V. V. Petrovsky1976
CCDB · cyper-only — Uhrikova, A. & V. Ferakova1978
CCDB · cyper-only — Ficini, G., F. Garbari, A. Giordani & P. E. Tomei1980
CCDB · cyper-only — Lve, . & D. Lve1981
CCDB · cyper-only — Lve, . & D. Lve1982b
CCDB · cyper-only — Javurkova-Jarolimova, V.1992
CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. IOPB chromosome number reports LXXVII. Taxon 31: 766–768.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Ficini, G., F. Garbari, A. Giordani & P. E. Tomei. 1980. Numeri cromosomici per la Flora Italiana: 683-689. Inform. Bot. Ital. 12: 113–116.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.
CCDB · ipcn-api-dl — Uhrikova, A. & V. Ferakova. 1978. In IOPB chromosome number reports LXI. Taxon 27: 375–392.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1976. Chromosome numbers of some Western Chukolka plant species, II. Bot. Žhurn. (Moscow & Leningrad) 61(7): 963–969.
CCDB · ipcn-api-dl — Rotreklova. 2004. Chromosome numbers for some species of vascular plants from Europe. Biologia (Bratislava) 59: 425–433.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — THIEBAUD, M.-A. 1970. Contribution a l'etude caryologique Eleocharis R. Br. en Suisse. Candollea 25: 209-219.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1973. Cytotaxonomy of Spanish plants. Monocotyledons. Lagascalia 3: 14 7-182. I
CCDB · book-indian_vol2 — Tanaka, N. 1937, 1948; Love, A. & Love, D. 1956b ; Jcrgensen. C.A. et a/. 1958; Harms, L.J. 1964; Uhri- kova, A. & Fcrakova, v. 1978
CCDB · eflora
CCDB · book-atlas-flowering-plants — Tanaka 1937
CCDB · kew — Zedek F, Smerda J, Smarda P, Bures P. 2010. Correlated evolution of LTR retrotransposons and genome size in the genus Eleocharis. BMC Plant Biology 10: 265.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1981a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 845-851.
CCDB · CromoCat 2015 — Uhríková, A. & V. Feráková. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXI]. Taxon 27(4): 379.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1973). Cytotaxonomy of Spanish plants. II. Monocotyledons. Lagascalia 3(2): 147-182.
CCDB · CromoCat 2015 — Rotreklova. (2004). Chromosome numbers for some species of vascular plants from Europe. Biologia (Bratislava) 59: 425–433.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982d). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVII]. Taxon 31(4): 766-768.
2n 182×CCDB · iapt · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · CromoCat 2015 — Chepinoga, V.V., Gnutikov, A. A., Enuschenko, I. V. & Rosbakh, S. A. (2009). IAPT/IOPB Chromosome Data 8 Taxon 58 (4): 1281-1282
n 106×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · cyper-only — Harms, L. J.1964
CCDB · cyper-only — Taylor, R. L. & G. A. Mulligan1968
CCDB · cyper-only — Dalgaard, V.1989
CCDB · ipcn-api-dl — Dalgaard, V. 1989. Additional chromosome numbers in vascular plants from the Disko Bugt area (west Greenland). Willdenowia 19: 199–213.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · CromoCat 2015 — Dalgaard, V. (1989). Additional chromosome numbers in vascular plants from the Disko Bugt area (west Greenland). Willdenowia 19: 199-213.
n 52×CCDB · cyper-only · CCDB · book-ipcn73-74
CCDB · cyper-only — 236Harms, L. J.1964
CCDB · book-ipcn73-74 — RATH, S.P., & S.N. PATNAIK. 1974. Cytological studies in Cyperaceae with special reference to its taxonomy I. Cytologia 39: 341-352.
08Occurrence & distribution
Record type54 759 records
Wild obs. + sensor43 667
Museum / vouchered10 892
Cultivated / captive14
Other186
Origin
Native1 768
Range
Area of Occupancy AOO92 596 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy47% within 1 km
≤100 m 10 836≤1 km 7 060≤10 km 19 423>10 km 529
37 848 georeferenced · 5 819 without coordinates
Open the mapobservation + sensor43 667
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 959≤1 km 1 583≤10 km 2 558>10 km 872
5 972 georeferenced · 4 920 without coordinates
Open the institutions mapphysical evidence10 892
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 11
11 georeferenced · 3 without coordinates
Open the mapnot free-living14
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions194 of 352 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 602 |
| Uniwersytet Wrocławskilocation not on record | 430 |
| LDlocation not on record | 382 |
| Olocation not on record | 377 |
| Moscow State Universitylocation not on record | 293 |
| Québec, CA | 269 |
| Madison, US | 253 |
| St. Paul, US | 234 |
| Philadelphia, US | 186 |
| Metsähallituslocation not on record | 185 |
| BRNUlocation not on record | 170 |
| Flagstaff, US | 165 |
| Trondheim, NO | 163 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 156 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 151 |
| MeiseBGlocation not on record | 143 |
| Brussel, BE | 141 |
| Wuzhou, CN | 135 |
| Tartu, EE | 131 |
| Oulu, FI | 126 |
| Bronx, US | 114 |
| Chongqing Museumlocation not on record | 112 |
| Acadia Universitylocation not on record | 111 |
| SLU Artdatabankenlocation not on record | 108 |
| Green Bay, US | 108 |
| Ann Arbor, US | 105 |
| Uppsala, SE | 103 |
| Victoria, CA | 88 |
| Guasave, MX | 85 |
| Durango, MX | 80 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 79 |
| University of New Hampshirelocation not on record | 76 |
| Oskarshamn, SE | 75 |
| Saint Louis, US | 73 |
| Montréal, CA | 71 |
| Mexico City, MX | 70 |
| Toronto, CA | 70 |
| TROMlocation not on record | 65 |
| BFLlocation not on record | 64 |
| Nagatoro-machi, Chichibu-gun, JP | 62 |
| Pullman, US | 60 |
| Moscow, US | 59 |
| Garðabær, IS | 58 |
| Burlington, US | 55 |
| Bern, CH | 53 |
| Missoula, US | 53 |
| WTUlocation not on record | 53 |
| University of Alberta Museumslocation not on record | 52 |
| Turku, FI | 52 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 46 |
| International Salmonella Centre (W.H.O.)location not on record | 45 |
| Corvallis, US | 45 |
| Université Lavallocation not on record | 45 |
| CJBGlocation not on record | 43 |
| Salzburg, AT | 42 |
| Bloomington, US | 41 |
| BIO-UNIPIlocation not on record | 41 |
| ASUlocation not on record | 38 |
| South Kensington, GB | 38 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 37 |
| New Haven, US | 37 |
| Saint John, CA | 37 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 36 |
| Provincia di Livornolocation not on record | 35 |
| Mexico City, MX | 35 |
| University of Stellenboschlocation not on record | 35 |
| Vancouver, CA | 33 |
| Lincoln, US | 32 |
| Irkutsk State Universitylocation not on record | 32 |
| Philadelphia, US | 32 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 32 |
| Bergen, NO | 31 |
| Allentown, US | 30 |
| Claremont, US | 29 |
| Riverside, US | 29 |
| US | 29 |
| 29 | |
| MAlocation not on record | 29 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 27 |
| Philadelphia, US | 27 |
| Jyväskylä, FI | 26 |
| Denver, US | 25 |
| Chapel Hill, US | 25 |
| Phoenix, US | 24 |
| Santa Barbara, US | 24 |
| Dresden, DE | 23 |
| Davis, US | 21 |
| Entomological Society of Latvialocation not on record | 21 |
| LfUlocation not on record | 21 |
| Provo, US | 21 |
| Bangkok, TH | 20 |
| Austin, US | 20 |
| Albuquerque, US | 20 |
| Chadron, US | 19 |
| Kuopio, FI | 19 |
| Jackson, US | 18 |
| CASlocation not on record | 17 |
| National Biodiversity Institute, Costa Ricalocation not on record | 17 |
| Xiamen, CN | 17 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 17 |
| Bozeman, US | 16 |
| KMNlocation not on record | 16 |
| Fredericton Stock Culture Collectionlocation not on record | 14 |
| Institute of the biological problems of the North FEB RASlocation not on record | 14 |
| Zürich, CH | 14 |
| Boise, US | 13 |
| Angwin, US | 12 |
| TUR-Alocation not on record | 12 |
| Canadian Department of Agriculturelocation not on record | 12 |
| Pocatello, US | 12 |
| València, ES | 12 |
| Arcata, US | 11 |
| Staten Island, US | 11 |
| College Park, US | 11 |
| Millersville, US | 11 |
| Berlin, DE | 11 |
| Frauenfeld, CH | 11 |
| GJOlocation not on record | 10 |
| Salamanca, ES | 10 |
| San Luis Obispo, US | 10 |
| Christchurch, NZ | 10 |
| WINlocation not on record | 10 |
| Pittsburg, US | 10 |
| Logan, US | 10 |
| Caldwell, US | 10 |
| Mlocation not on record | 10 |
| Taipei, TW | 10 |
| Columbia, US | 9 |
| nbflocation not on record | 9 |
| Ciudad de México, MX | 9 |
| Tampa, US | 9 |
| Fort Worth, US | 9 |
| Taipei, TW | 9 |
| Dekalb, US | 9 |
| Porrentruy, CH | 9 |
| Aarhus, DK | 9 |
| Auckland, NZ | 9 |
| DBF-NHMDlocation not on record | 9 |
| Yukon Universitylocation not on record | 8 |
| Durham, US | 8 |
| National Institute of Biological Resourceslocation not on record | 8 |
| Montréal, CA | 8 |
| Portland, US | 8 |
| Whitehorse, CA | 8 |
| BDBClocation not on record | 8 |
| KOMlocation not on record | 8 |
| Servico de Microbiologia e Imunologialocation not on record | 8 |
| EL PASO, US | 7 |
| Tilburg, NL | 7 |
| Nijmegen, NL | 7 |
| San Angelo, US | 7 |
| Zürich, CH | 7 |
| Whitewater, US | 7 |
| San Diego, US | 6 |
| Henderson State Universitylocation not on record | 6 |
| Adam Mickiewicz University in Poznańlocation not on record | 6 |
| Valdosta State Universitylocation not on record | 6 |
| Tuscaloosa, US | 6 |
| Juriquilla, MX | 6 |
| McWane Science Centerlocation not on record | 6 |
| Davenport, US | 6 |
| BAYLUlocation not on record | 6 |
| Chicago, US | 5 |
| Emporia, US | 5 |
| BClocation not on record | 5 |
| NMBU:MINAlocation not on record | 5 |
| Wellington, NZ | 5 |
| Forssa, FI | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 5 |
| Durango, US | 5 |
| University of Winnipeglocation not on record | 5 |
| SZUlocation not on record | 5 |
| Porvoo, FI | 5 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| Tromso University Museumlocation not on record | 5 |
| DULlocation not on record | 5 |
| Uniwersytet Warszawskilocation not on record | 5 |
| Spearfish, US | 5 |
| PrivatHerblocation not on record | 5 |
| Keene State Universitylocation not on record | 4 |
| Mississippi State, US | 4 |
| Royal Botanic Garden Edinburghlocation not on record | 4 |
| Lubbock, US | 4 |
| Kew, GB | 4 |
| Tallinn, EE | 4 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 4 |
| Bend, US | 4 |
| Stockholm, SE | 4 |
| Madrid, ES | 4 |
| UnBlocation not on record | 4 |
| Anchorage, US | 4 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 4 |
| ZRC-SAZUlocation not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Jena Microbial Resource Collectionlocation not on record | 4 |
| Orem, US | 4 |
| Williamsburg, US | 4 |
| Ciudad de México, MX | 4 |
| Wlocation not on record | 3 |
| Ypsilanti, US | 3 |
| Armidale, AU | 3 |
| Bando, JP | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| University of Southern Mississippilocation not on record | 3 |
| Alicante, ES | 3 |
| PRClocation not on record | 3 |
| Urumqi, CN | 3 |
| Fayetteville, US | 3 |
| Tall Timbers Research Stationlocation not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| GAlocation not on record | 3 |
| Rovaniemi, FI | 3 |
| Clemson, US | 3 |
| CICYTEXlocation not on record | 3 |
| Taipei, TW | 3 |
| Vitoria, ES | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Knoxville, US | 3 |
| Beijing, CN | 3 |
| US | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 2 |
| Siberian Federal Universitylocation not on record | 2 |
| Fargo, US | 2 |
| H-Adlerlocation not on record | 2 |
| Little Rock, US | 2 |
| Fairfax, US | 2 |
| No collectionlocation not on record | 2 |
| Chicago, US | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Canadian Museum of Naturelocation not on record | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Macomb, US | 2 |
| H-Hohlalocation not on record | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| University of Birminghamlocation not on record | 2 |
| GMBAlocation not on record | 2 |
| ISAlocation not on record | 2 |
| Universität Göttingenlocation not on record | 2 |
| Namur, BE | 2 |
| Santa Cruz de la Sierra, BO | 2 |
| Denton, US | 2 |
| Quito, EC | 2 |
| Tlalnepantla, MX | 2 |
| Chapingo, MX | 2 |
| UGentlocation not on record | 2 |
| Chicago, US | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| MEXUlocation not on record | 2 |
| AUAlocation not on record | 2 |
| Guangzhou, CN | 2 |
| Universidad de los Andes (UniAndes)location not on record | 2 |
| BG-NMNHSlocation not on record | 2 |
| Weber State Universitylocation not on record | 2 |
| Rocky Mountain Biological Laboratorylocation not on record | 2 |
| BMlocation not on record | 2 |
| Cheney, US | 2 |
| US | 2 |
| Trois-Rivières, CA | 2 |
| UTPLlocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| NoColllocation not on record | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Bourges, FR | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Texas Lutheran Universitylocation not on record | 2 |
| University of Wisconsinlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| University of Manitoba Herbariumlocation not on record | 2 |
| Miami, US | 1 |
| Paris, FR | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| LINUlocation not on record | 1 |
| Austin, US | 1 |
| US | 1 |
| Morelia, MX | 1 |
| Hamilton, US | 1 |
| BSBIlocation not on record | 1 |
| Fredericksburg, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Anchorage, US | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Barcelona, ES | 1 |
| Henderson, US | 1 |
| Granada, ES | 1 |
| Santa Cruz, US | 1 |
| Long Beach, US | 1 |
| Podgorica, ME | 1 |
| Badajoz, ES | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Fribourg, CH | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| USFSlocation not on record | 1 |
| Jefferson City, US | 1 |
| Tacoma, US | 1 |
| Peking Universitylocation not on record | 1 |
| Portland, US | 1 |
| Stephenville, US | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| ifplocation not on record | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| Forest Herbarium Ibadan (FHI)location not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| GB | 1 |
| Portland, US | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Pomona Collegelocation not on record | 1 |
| Irvine, US | 1 |
| New Brunswick, US | 1 |
| Dover, US | 1 |
| Altos de Pipe, VE | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Northridge, US | 1 |
| La Paz, BO | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Boumlocation not on record | 1 |
| San Sebastián, ES | 1 |
| Ensenada, MX | 1 |
| Los Angeles, US | 1 |
| Elocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Lausanne, CH | 1 |
| Awka, NG | 1 |
| H-Schuhwlocation not on record | 1 |
| GZUlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Asheville, US | 1 |
| Oswego, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Tomioka, JP | 1 |
| TAIElocation not on record | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Copenhagen, DK | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Jurica-Suchy Nature Museumlocation not on record | 1 |
| NSMKlocation not on record | 1 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 1 |
| Waverly, US | 1 |
| MFUlocation not on record | 1 |
| Madrid, ES | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Edinburgh, GB | 1 |
352 institutions · 9 412 of 10 892 vouchered records shown · 1 445 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA34 detections
Where the DNA of Eleocharis acicularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found34
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 34 detections have coordinates
Open the map6 countries0
Area that is seasonally inundatedwetlandAquatic in shallows with Chara, Nuphar, Myri…MudPhenology=FFL
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.5 °C 8.50–17.0
Seasonal swing summer↔winter23.6 °C
Max temp (day)17.8 °C 11.9–20.9
Min temp (night)9.40 °C 5.10–13.1
Precipitation82.9 mm/mo 59.6–129
Air humidity61.3 % 57.2–64.6
Moisture balance-8.30 mm/mo -57.8–69.6
Vapour deficit632 Pa 433–780
Wind speed3.30 m/s 1.80–5.50
Cloud cover48.1 % 31.2–64.4
CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.