Electranthera mutica

(DC.) Mesfin, Crawford & Pruski · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Electranthera

At a glance

Occurrence records112

Data sources9

Biological traits13

DNA specimens0

eDNA detections1

Sources9 archives

Databases and archives Electranthera mutica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS13 compounds

Occurrence & distributionGBIF112 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 56

01Narrative

Coreopsis mutica лат. — вид травянистых растений рода Кореопсис (Coreopsis) семейства Астровые (Asteraceae), растёт в Центральной и Северной Америке.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass2.36 mg

Seed mass max2.99 mg

Seed mass min1.73 mg

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition13 compounds

Compounds documented for Electranthera mutica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Camphane monoterpenoids4

Cadinane sesquiterpenoids2

Prenyl quinone meroterpenoids1

Cholestane steroids $ Stigmastane steroids1

Stigmastane steroids1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Bornyl ferulate	present	LOTUS
(1R,4R)-1,7,7-Trimethylbicyclo[2.2.1]heptane-2beta-ol 3-(4-hydroxyphenyl)acrylate	present	LOTUS
(6Z,10R)-3,6,10-trimethyl-5,8,9,10-tetrahydrobenzo[8]annulen-2-ol	present	LOTUS
(6Z,10S)-3,6,10-trimethyl-5,8,9,10-tetrahydrobenzo[8]annulen-2-ol	present	LOTUS
1-Amino-2-propanol	present	LOTUS
[(1R,2S,4R)-1,7,7-trimethyl-2-bicyclo[2.2.1]heptanyl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS
beta-Sitosterol	present	LOTUS
Bornyl ferulate	present	LOTUS
Butein	present	LOTUS
Perezone	present	LOTUS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Electranthera mutica has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY561298.1 ↗208 bp

ACGT

TCGAACCCTGATAGCAGAACAACCCGTGAACAAGTAAGAACAATTGGCTTTGCGAGGACCGAAGCTTTGGTTTTGATCCTCGTAAGGCCT …

Coreopsis mutica internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Electranthera mutica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Ploidypolyploid inferred

Chromosome records56–562n range56median56mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 562×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — CRAWFORD, D.J. 1970. Systematic studies in Mexican Coreopsis . (Compositael, Coreopsis mutica: flavonoid chemistry, chromosome numbers, morphology, and hybridization. Brittonia 22: 93-111.

n 283×CCDB · ipcn-api-dl · CCDB · book-ipcn72

CCDB · ipcn-api-dl — Crawford, D. J. 1981. A new variety of Coreopsis mutica (Compositae) from Mexico. Brittonia 33: 547–551.

CCDB · ipcn-api-dl — Robinson, H., A. M. Powell, R. M. King & J. F. Weedin. 1981. Chromosome Numbers in Compositae, XII: Heliantheae. Smithsonian Contr. Bot. 52: 1–28.

CCDB · book-ipcn72 — SOLBRIG, O.T., D.W. KYHOS, M. POWELL, & P.H. RAVEN. 1972. Chromosome numbers in Compositae VIII: Heliantheae. Amer. J. Bot. 59: 869-878.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type112 records

Wild obs. + sensor106

Museum / vouchered6

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 42≤1 km 15≤10 km 7>10 km 5

69 georeferenced · 37 without coordinates

Open the mapobservation + sensor106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	2
University of Stellenboschlocation not on record	2
Anchorage, US	1
Guatemala City, GT	1

4 institutions · 6 of 6 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Electranthera mutica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)